Veterinary medicine for horses encompasses the study and application of medical practices to diagnose, treat, and prevent diseases in equine species. This field involves a comprehensive understanding of equine anatomy, physiology, pathology, and pharmacology. Veterinary practitioners employ a range of diagnostic tools and therapeutic interventions to address health issues in horses, including lameness, gastrointestinal disorders, respiratory conditions, and infectious diseases. Preventative care, such as vaccination and deworming programs, is also a significant aspect of equine veterinary medicine. This page gathers peer-reviewed research studies and scholarly articles that explore various aspects of veterinary medicine as it pertains to horses, including advancements in diagnostic techniques, treatment protocols, and preventive health strategies.
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Leschke DH, Muir GS, Hodgson JK, Coyle M, Horn R, Bertin FR.Diseases associated with insulin dysregulation (ID), such as equine metabolic syndrome and pituitary pars intermedia dysfunction, are of interest to practitioners because of their association with laminitis. Accurate insulin concentration assessment is critical in diagnosing and managing these diseases. Objective: To determine the effect of time, temperature, and collection tube type on insulin concentrations in horses at risk of ID. Methods: Eight adult horses with body condition score >6/9. Methods: In this prospective study, subjects underwent an infeed oral glucose test 2 hours before...
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Isgren CM, Salem SE, Singer ER, Wylie CE, Lipreri G, Graham RJTY, Bladon B, Boswell JC, Fiske-Jackson AR, Mair TS, Rubio-Martínez LM.Previous studies investigating factors associated with survival following endoscopic treatment of contamination/sepsis of the calcaneal bursa are limited. Objective: To investigate the factors associated with survival in horses with contamination/sepsis of the calcaneal bursae treated endoscopically and to describe the bacterial isolates involved in the synovial infections. Methods: Retrospective analysis of clinical records. Methods: Medical records from 128 horses with contamination/sepsis of the calcaneal bursae treated by endoscopic lavage at seven equine hospitals were reviewed. A follow-...
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
Chen JW, Stefanovski D, Haughan J, Jiang Z, Boston R, Soma LR, Robinson MA.Extracorporeal shockwave therapy (ESWT) can potentially mask painful injuries in equine athletes. Tests to detect whether a horse has received ESWT prior to competition are needed. Extracorporeal shockwave therapy is known to affect inflammatory mediators in other species, and if these mediators are altered in the horse, these could serve as biomarkers of ESWT. Objective: To test the hypothesis that a single application of ESWT will alter the circulating protein concentrations of 10 inflammatory mediators in horse plasma. Methods: Prospective repeated measures experimental study. Methods: Elev...
Yao C.The kinetoplastid protozoan Leishmania spp. cause leishmaniasis, which clinically exhibit mainly as a cutaneous, mucocutanous or visceral form depending upon the parasite species in humans. The disease is widespread geographically, leading to 20 000 annual deaths. Here, leishmaniases in both humans and animals, reservoirs and sand fly vectors on the Caribbean islands are reviewed. Autochthonous human infections by Leishmania spp. were found in the Dominican Republic, Guadeloupe and Martinique as well as Trinidad and Tobago; canine infections were found in St. Kitts and Grenada; and equine infe...
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Thompson RE, Johnson AK, Prado TM, Premanandan C, Brown ME, Whitlock BK, Pukazhenthi BS.Availability of viable frozen-thawed endometrial tissues could facilitate detailed studies into physiologic and disease processes influencing the endometrium. This study was designed to investigate the cryosurvival of equine endometrial tissue. Previous studies in the human and horse have focused on cryopreservation of dissociated endometrial cells. To our knowledge, there are no studies on cryopreservation of endometrial explants. Our objectives were to 1) determine the influence of differing concentrations of the permeating cryoprotectant dimethyl sulfoxide (MeSO) on viability, structural in...
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Fernandes CB, Ball BA, Loux SC, Boakari YL, Scoggin KE, El-Sheikh Ali H, Cogliati B, Esteller-Vico A.Anatomical and molecular changes in the cervical barrier in women are a fundamental part of the pathogenesis of pregnancy loss associated with chorioamnionitis. However, there is little information regarding changes in the cervix associated with ascending infection in pregnant mares. To better characterize morphological and molecular changes in the cervix during placentitis, we examined full thickness histology and mRNA expression for a number of inflammatory and endocrine factors in the mucosa and stroma of the cervix of mares (n = 5) after experimental induction of placentitis via transc...
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =...
Riddell LP, Yoshimura S, MacKay AV, Wilson DG.A 17-year-old Quarter horse mare was presented because of traumatic luxation of the fifth sacral and first coccygeal vertebrae resulting in loss of sensation, motor function, and perfusion of the tail. The case was complicated by an associated tail head hematoma. Due to the severity of the injury, tail amputation was performed at the level of the luxation. Tail amputations in horses at the sacrococcygeal junction following a suspected tail pull injury are infrequently reported in the literature. . Une jument Quarter horse âgée de 17 ans fut présentée pour cause de luxation traumatique de l...
Melinyshyn H.A 13-year-old Morgan crossbred mare was presented in May 2018 with a 10-cm mass on the medial aspect of the left hind fetlock. In September and November 2018 and June 2019 the mass was incompletely excised and continued to grow. A diagnosis of spindle cell tumor, consistent with equine sarcoid, was made based on histopathology from the last excision. . Une jument Morgan croisée âgée de 13 ans a été présentée en mai 2018 avec une masse de 10 cm sur l’aspect médial du boulet arrière gauche. En septembre et novembre 2018 ainsi qu’en juin 2019, la masse avait été excisée de manièr...
Blanco-Lobo P, Rodriguez L, Reedy S, Oladunni FS, Nogales A, Murcia PR, Chambers TM, Martinez-Sobrido L.Vaccination remains the most effective approach for preventing and controlling equine influenza virus (EIV) in horses. However, the ongoing evolution of EIV has increased the genetic and antigenic differences between currently available vaccines and circulating strains, resulting in suboptimal vaccine efficacy. As recommended by the World Organization for Animal Health (OIE), the inclusion of representative strains from clade 1 and clade 2 Florida sublineages of EIV in vaccines may maximize the protection against presently circulating viral strains. In this study, we used reverse genetics tech...
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
de Paula VB, Canola PA, Rivera GG, Z Filho D, Amaral GPD, Ferraz GC, Ferraudo AS, Canola JC.To investigate effects of postural changes and bladder distention on intrabladder pressure whilst estimating intra-abdominal pressure in horses. Two-year cohort study. Patients admitted for elective surgical procedures unrelated to gastrointestinal or genitourinary tract. School of Agricultural and Veterinarian Sciences, Jaboticabal, SP, Brazil. 20 adult horses, 11 males (stallions and geldings) and 9 females; between 3.5 and 12 years, weighing 350 to 500 kg. Intra-abdominal pressure was directly-recorded through abdominocentesis at the ventral midline with a fluid-filled system. Intrabladder ...
Dai F, Dalla Costa A, Bonfanti L, Caucci C, Di Martino G, Lucarelli R, Padalino B, Minero M.The present work aimed to evaluate the efficacy of a self-loading training using positive reinforcement on stress-related behaviors shown by meat horses during loading procedures into a truck. Thirty-two meat horses ( = 18; = 14; 6 month-old) were included in the study. All horses had limited interactions with the farmer and were not used to be restrained nor lead by halter. Horses were divided in two groups: Control Group (C; = 14) and Training Group (T; = 18). T horses were trained to self-load: in order to teach the horses to enter into the truck, a targeting training technique throughou...
Beste KJ, Lawhon SD, Chamoun-Emanuelli AM, Duff AH, Coleman MC, Griffin CE, Hardy J, Whitfield-Cargile CM.Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...
Rahmani V, Häyrinen L, Kareinen I, Ruohoniemi M.The progression of equine odontoclastic tooth resorption and hypercementosis (EOTRH) has not been completely evaluated, and currently, the only effective treatment is extraction of severely affected teeth. We aim to describe how the disease relates to the history and clinical findings and to report on the outcome in individual horses. This case series comprises data collected from 20 horses (age 14-29 years old) with radiographic findings of EOTRH in their incisor and/or canine teeth. Most horses affected with EOTRH in this study were admitted for dental problems, but some for other complaints...
Bourély C, Cazeau G, Jarrige N, Jouy E, Haenni M, Lupo A, Madec JY, Leblond A, Gay E.To examine the relevance of co-resistance to amoxicillin and tetracycline as an indicator of multidrug resistance (MDR) in animal health. Methods: isolates collected between 2012 and 2016 by the French surveillance network for antimicrobial resistance in diseased animals (RESAPATH) were analyzed. The proportions of MDR isolates and the proportions of isolates presenting co-resistance to amoxicillin and tetracycline were calculated for seven animal species (cattle, horse, dog, swine, poultry, duck, and turkey). The degree of agreement between these two proportions was estimated by calculating ...
Malalana F, Ireland JL, Pinchbeck G, McGowan CM.Uveitis appears to be less prevalent in the UK compared with other parts of the world and studies characterising the disease in the UK are lacking. The objectives of this retrospective study were to describe acute and recurrent cases presenting for management of uveitis in a referral hospital on the North West of England and compare the signalment of horses presenting with uveitis with the equine hospital population during the same period. Methods: Medical records of horses presented to the referral Equine Hospital, University of Liverpool with signs of uveitis between 2008 and 2018 were revie...
Draper ACE, Cahalan SD, Goodwin D, Perkins J, Piercy RJ.Equine recurrent laryngeal neuropathy (RLN) is a naturally occurring model of length-dependent axonopathy characterized by asymmetrical degeneration of recurrent laryngeal nerve axons (RLn). Distal RLn degeneration is marked, but it is unclear whether degeneration extends to include cell bodies (consistent with a neuronopathy). With examiners blinded to RLN severity, brainstem location, and side, we examined correlations between RLN severity (assessed using left distal RLn myelinated axon count) and histopathological features (including chromatolysis and glial responses) in the nucleus ambiguu...
Cuervo-Arango J, Claes AN, Stout TAE.In recent years, the number of equine invitro-produced embryos (IVP) has increased markedly; as yet, there are few reports on what constitutes an 'ideal' recipient for an IVP embryo. This study retrospectively investigated the effects of recipient mare oestrous cycle characteristics on the likelihood of pregnancy after transfer of IVP (n=264) and invivo-derived embryos (n=262). IVP embryos tolerated only a narrow window of recipient mare 'synchrony', with transfer on Day 4 after ovulation resulting in a higher likelihood of ongoing pregnancy (69%) than transfer on Days 3, 5 or 6 (53.2%, 41.3% ...
Lindenberg F, Krych L, Kot W, Fielden J, Frøkiær H, van Galen G, Nielsen DS, Hansen AK.Shortly after birth the mammalian gut is colonized, by a transient microbiota, highly susceptible to environment and diet, that eventually stabilizes and becomes the resident gut microbiota. In a window of opportunity during the colonization, oral tolerance is established towards resident bacteria. In this study, the development of the equine gut microbiota was investigated in ten foals from parturition until post weaning. We found great differences in the core species of the gut microbiota composition between time-matched samples on Day 7 and 20 post-partum. Between day 20 and Day 50 post-par...
Lyons ET, Tolliver SC, Drudge JH, Swerczek TW, Crowe MW.A total of 278 Thoroughbreds (less than 1 to 31 years old) were examined at necropsy (July 9, 1985, to Feb 2, 1986) in Kentucky for various internal parasites. Examination was not made of all the horses for each of the parasites. Specific parasites recovered from the stomach of foals (n = 30) and yearlings and older horses (n = 96) and percentage (in parentheses) of each age category infected, respectively, were as follows: Gasterophilus intestinalis 2nd instar (53% and 32%) and 3rd instar (37% and 24%); G nasalis 2nd instar (7% and 8%) and 3rd instar (7% and 10%); Habronema spp immature (7% a...
Lavoie-Lamoureux A, Beauchamp G, Quessy S, Martin JG, Lavoie JP.To compare innate immune responses of peripheral blood leukocytes from healthy and asymptomatic heaves-affected horses. Methods: Heaves-affected horses (n=5-6) and healthy controls (n=4-5) kept under low dust environments (pasture or shavings and pellets). Methods: Blood neutrophil and neutrophil-depleted cell populations were isolated using MACS system. Cells were incubated with or without bacterial products (lipopolysaccharide (LPS), 100 ng/mL and fMLP, 5 ng/mL, 5 h). Cytokine (IL-1β, IL-8, TNF, IL-4, INFγ and IL-10) and receptor (TLR4) mRNA expression was assessed by qPCR. TNF concentrati...
Maury W, Wright PJ, Bradley S.A novel strain of equine infectious anemia virus (EIAV) called vMA-1c that rapidly and specifically killed infected equine fibroblasts (ED cells) but not other infectible cell lines was established. This strain was generated from an avirulent, noncytopathic strain of EIAV, MA-1. Studies with this new cytolytic strain of virus have permitted us to define viral parameters associated with EIAV-induced cell killing and begin to explore the mechanism. vMA-1c infection resulted in induction of rapid cell death, enhanced fusogenic activity, and increased rates of spread in equine fibroblasts compared...
Bolwell CF, Rogers CW, French NP, Firth EC.Few studies have investigated the effect of having interruptions during training on future training and racing performance in Thoroughbred racehorses. The aim of this paper was to investigate the effect of having an interruption before the first trial on starting in a trial or a race. A prospective cohort study was used to record the training activity of a cohort of Thoroughbred racehorses, over two racing seasons. Fourteen racehorse trainers recorded information on the distances worked at canter and at fast speeds (<15s/200 m) and provided reasons for horses not training, or for having int...
Bazzano M, Laus F, Spaterna A, Marchegiani A.Nutritional supplements are widely used in the equine industry with the aim of improving horse health, sports or reproductive performances. Over the years, a number of studies have focused on investigating the effects of several dietary compounds on the quality and preservation of stallion semen. This paper reviews the literature available on the use of nutritional supplementation for the improvement of reproductive performance and semen quality in equine species, critically appraising the benefits and negative effects of several compounds found in complementary feeds such as PUFAs from differ...
D￮ LR, Stefanovski D, Boston RC, Boyle AG.To evaluate predictor variables for and complications associated with Streptococcus equi subsp equi infection (strangles) in horses. Methods: Retrospective case-control study. Methods: 108 horses with strangles (cases) and 215 horses without strangles (controls). Methods: Medical records from January 2005 through July 2012 were reviewed. Cases were defined as horses with clinical signs of strangles (pyrexia, retropharyngeal lymphadenopathy, and mucopurulent nasal discharge) that were associated with a confirmed strangles outbreak or had positive results for S equi on PCR assay or bacteriologic...
Léguillette R, Steinmann M, Bond SL, Stanton B.Poor performance is often suspected to be associated with EIPH in barrel racing horses; however, there are no published reports of EIPH for this discipline. The prevalence of EIPH in barrel racing horses is also unknown. Objective: This study was performed to determine the prevalence of EIPH and signs of airway inflammation in barrel racing horses under normal racing conditions in Alberta. Methods: About 170 barrel racing horses. Methods: Observational cross-sectional study. Tracheobronchoscopic examinations were performed at least 30 minutes postrace. Video recordings were scored off-site ind...
Hultén C, Tulamo RM, Suominen MM, Burvall K, Marhaug G, Forsberg M.A non-competitive chemiluminescence enzyme immunoassay for measuring serum amyloid A (SAA) in equine serum was developed. A polyclonal anti-equine-amyloid A antiserum specific for equine SAA was utilized, and the assay was standardized using highly purified equine SAA. An acute phase horse serum was calibrated against the purified SAA and was used as standard when running the assay. Serum SAA concentrations in the range of 3-1210 mg/l could be measured. The reference range of SAA in clinically healthy adult horses was <7 mg/l. The clinical validation of the assay comprised the SAA responses...
LeBlanc MM, Giguère S, Lester GD, Brauer K, Paccamonti DL.Ascending placentitis results in premature birth and high foal mortality. By understanding how placentitis induces premature delivery, it may be possible to develop diagnostic markers and to delay premature delivery pharmacologically, thereby decreasing perinatal foal mortality. Objective: To identify relationships between bacterial infection, inflammation and premature parturition in mares with experimentally induced placentitis. Methods: Experiment 1: Concentrations of allantoic fluid prostaglandins (PGs) F2alpha and E2 were measured in 8 mares after intracervical inoculation with Streptococ...
Pearson W, Orth MW, Lindinger MI.To evaluate inflammatory responses induced via intra-articular recombinant human interleukin (IL)-1beta treatment in horses receiving a dietary nutraceutical (DN; composed of mussel, shark cartilage, abalone, and Biota orientalis lipid extract) and assess the clinical effects of long-term DN administration. Methods: 22 healthy horses. Methods: 12 horses were fed 0, 15, 45, or 75 mg of DN (3 horses/treatment) daily for 84 days. General health and clinicopathologic variables were monitored at intervals. Ten other horses received 0 or 15 g of DN/d (5 horses/treatment) for 29 days (beginning day -...
Lear TL, Bailey E.Cytogenetic analyses of horses have benefited the horse industry by identifying chromosomal aberrations causing congenital abnormalities, embryonic loss and infertility. Technical advances in cytogenetics enabled the identification of chromosome specific aberrations. More recently, advances in genomic tools have been used to more precisely define chromosome abnormalities. In this report we review the history of equine clinical cytogenetics, identify historical landmarks for equine clinical cytogenetics, discuss how the current use of genomic tools has benefited this area, and how future genomi...
Ceriotti S, Bullone M, Leclere M, Ferrucci F, Lavoie JP.Pulmonary hypertension and cor pulmonale are complications of severe equine asthma, as a consequence of pulmonary hypoxic vasoconstriction. However, as pulmonary hypertension is only partially reversible by oxygen administration, other etiological factors are likely involved. In human chronic obstructive pulmonary disease, pulmonary artery remodeling contributes to the development of pulmonary hypertension. In rodent models, pulmonary vascular remodeling is present as a consequence of allergic airway inflammation. The present study investigated the presence of remodeling of the pulmonary arter...
Cordeiro Rde A, Bittencourt PV, Brilhante RS, Teixeira CE, Castelo-Branco Dde S, Silva ST, De Alencar LP, Souza ER, Bandeira Tde J, Monteiro AJ....Respiratory infections are a common problem among equines and occur with variable rates of morbidity and mortality. Although some fungal species are considered primary agents of respiratory tract infections in several mammals, their relevance in respiratory diseases of equines is frequently neglected. In the present study, we performed an active search for Candida spp. in the nasal cavity of horses. The presence of Candida spp. was investigated through the use of nasal swabs that were streaked on culture media. These yeasts were identified through physiological testing and their in vitro antif...
Boeta M, Zarco L.The role of eCG during pregnancy was evaluated through the study of the temporal relationships between changes in eCG and progesterone concentrations and the formation of supplementary corpora lutea (SCL) in mares impregnated with donkey semen (mule pregnancies) or with horse semen (equine pregnancies). Concentrations of eCG were higher (p<0.01) in equine than in mule pregnancies between weeks 6.5 and 13. Progesterone concentrations were higher in equine than in mule pregnancies between weeks 9 and 17. All animals developed at least one SCL, but more SCL accumulated during equine pregnancie...
van Loon G, Fonteyne W, Rottiers H, Tavernier R, Jordaens L, D'Hont L, Colpaert R, De Clercq T, Deprez P.The purpose of the present study was to develop a feasible and safe technique for dual-chamber pacemaker implantation in healthy horses. Implantation was performed in a standing, tranquilized horse and in ponies. Atrial and ventricular leads were transvenously inserted through the cephalic vein, and a subcutaneous pacemaker pocket was created between the lateral pectoral groove and the manubrium sterni in 6 equids. Positioning of each lead was guided by echocardiography and by measuring the electrical characteristics of the lead. The implantation procedure lasted about 4 hours in each animal a...
Ghallab AM, Shahat AM, Fadl AM, Ayoub MM, Moawad AR.The aim of the present study was to evaluate the effects of supplementation of semen extender with various non-enzymatic antioxidants on the quality of cooled or cryopreserved Arabian stallion spermatozoa. Semen collected from four pure Arabian stallions was centrifuged at 600g for 15 min. Spermatozoa were then diluted in INRA-82 extender supplemented with bovine serum albumin (BSA; 0, 10, 15 and 20 mg/mL) or trehalose (0, 75, 100 and 150 mM) or zinc sulphate (0, 100, 150 and 200 μM). The diluted semen was then either cooled at 5 °C or cryopreserved in 0.5-ml plastic straws. After cooli...
Langley R, Morris T.Millions of individuals are in contact with horses through occupational or recreational activities. Injuries from horses are responsible for over 100,000 emergency room visits each year in the United States. Although various types of traumatic injuries related to direct contact with horses are well described, roughly 3% to 4.5% of all reported injuries are due to bites by equines. The immediate injuries are commonly either blunt or penetrating trauma to local tissue; however, the bite exposure may also transmit a microbial agent of equine origin that can lead to a zoonotic infection. In almost...
Sessions-Bresnahan DR, Carnevale EM.Obesity in many species is associated with reduced fertility and increased risk of metabolic disorders and cardiovascular dysfunction in offspring. Equine metabolic syndrome (EMS) is associated with obesity and characterized by insulin resistance, decreased adiponectin, and elevated insulin, leptin, and pro-inflammatory cytokines. These alterations can potentially disrupt follicular development and impair fertility. We hypothesized that mares with EMS have an altered follicular environment when compared to their normal counterparts, affecting gene regulation for follicle and oocyte maturation....
Tremoleda JL, Schoevers EJ, Stout TA, Colenbrander B, Bevers MM.Meiotic maturation of mammalian oocytes is a complex process during which microfilaments and microtubules provide the framework for chromosomal reorganisation and cell division. The aim of this study was to use fluorescence and confocal laser scanning microscopy to examine changes in the distribution of these important cytoskeletal elements and their relationship to chromatin configuration during the maturation of horse oocytes in vitro. Oocytes were cultured in M199 supplemented with pFSH and eLH and, at 0, 12, 24, and 36 hr after the onset of culture, they were fixed for immunocytochemistry ...
Nagy A, Murray JK, Dyson SJ.There is limited information on risk factors for elimination from endurance rides. Objective: To assess risk factors for elimination for lameness and metabolic reasons from Fédération Equestre Internationale (FEI) endurance rides of 80-160 km distance. Methods: Unmatched case-control. Methods: Venue-, horse- and rider-related data were collected from the FEI website. Data on weather conditions and terrain were collected at the venue. Univariable and multivariable logistic regression analyses were used to assess risk factors for elimination for lameness and metabolic reasons, respectively. Re...
Bogedale K, Jagannathan V, Gerber V, Unger L.The aim of this study was to investigate microRNA (miRNA) differential expression in the two most common equine skin tumours, equine sarcoid (ES) and squamous cell carcinoma (SCC), and its potential influence on the tumour microenvironment at post-transcriptional level. We investigated miRNA fingerprints in four subgroups: mild (ESM) and aggressive (ESA) ES and ocular SCC (oSCC) and genital SCC (gSCC). Three tumours and three control samples were included in each of the four subgroups. Following next generation sequencing, miRNA differential expression analysis using DESeq2 was carried out. Pa...
Jacks S, Giguère S, Prescott JF.Rhodococcus equi is a facultative intracellular pathogen that causes pneumonia in foals but does not induce disease in adult horses. Virulence of R. equi depends on the presence of a large plasmid, which encodes a family of seven virulence-associated proteins (VapA and VapC to VapH). Eradication of R. equi from the lungs depends on gamma interferon (IFN-gamma) production by T lymphocytes. The objectives of the present study were to determine the relative in vivo expression of the vap genes of R. equi in the lungs of infected foals, to determine the recall response of bronchial lymph node (BLN)...
Lange CE, Tobler K, Ackermann M, Favrot C.The number of recognized papillomavirus (PV) species and potential PV genera has dramatically been increasing throughout the past decade. It seems that every host species might potentially harbour a large set of PVs, while the PVs of each species appear to belong to only a few genera. In horses at least three conditions beside the equine sarcoid have been described, being supposedly PV induced namely classical equine papillomas, genital papillomas and aural plaques. We were able to identify the DNA of novel equine PVs (EcPVs) in the two latter disorders where PV involvement had been predicted....
Smith AV, Wilson C, McComb K, Proops L.Signals of dominance and submissiveness are central to conspecific communication in many species. For domestic animals, sensitivities to these signals in humans may also be beneficial. We presented domestic horses with a free choice between two unfamiliar humans, one adopting a submissive and the other a dominant body posture, with vocal and facial cues absent. Horses had previously been given food rewards by both human demonstrators, adopting neutral postures, to encourage approach behaviour. Across four counterbalanced test trials, horses showed a significant preference for approaching the s...
Firshman AM, Borgia LA, Valberg SJ.To compare effects of training on conventional and underwater treadmills on fiber properties and metabolic responses of the superficial digital flexor (SDF) and gluteal muscles to high-speed exercise in horses. Methods: 6 unconditioned Quarter Horse-type horses. Methods: 6 horses were walked on underwater and conventional treadmills for 5 d/wk (maximum, 40 min/d) for 8 weeks in a randomized crossover design (60-day detraining period). Horses underwent a standardized exercise test (SET) at high speed before and after training. Analyte concentrations and fiber characteristics were measured in mu...
Whitesell K, Stefanovski D, McDonnell S, Turner R.The stallion Breeding Soundness Examination (BSE), as proposed by the Society for Theriogenology, recommends that a stallion produce a minimum of one billion progressively motile, morphologically normal sperm (PMMNS) in the second of two ejaculates collected 1 h apart to be classified as a Satisfactory Prospective Breeder. With this in mind, the first objective of this study was to determine if the classification outcome of the traditional BSE differs depending on the methods used to evaluate sperm motility, morphology and concentration. We hypothesized that application of Computer Assisted ...
Haughan J, Jiang Z, Stefanovski D, Moss KL, Ortved KF, Robinson MA.Gene therapy promotes the expression of missing or defective genes and can be curative following administration of a single dose. Gene therapy is prohibited in equine athletes by regulatory bodies due to the high potential for abuse and novel analytical methods are needed for detection. The goal of this study was to detect the administration of an experimental gene therapy: a recombinant adeno-associated viral vector (rAAV) carrying a transgene for the anti-inflammatory cytokine IL-10 (rAAV-IL10). Twelve horses were randomly assigned to receive an intra-articular injection of rAAV-IL10 or phos...
Han H, Zhang Q, Gao K, Yue X, Zhang T, Dang R, Lan X, Chen H, Lei C.In contrast to high genetic diversity of mitochondrial DNA (mtDNA), equine Y chromosome shows extremely low variability, implying limited patrilines in the domesticated horse. In this study, we applied direct sequencing and restriction fragment length polymorphism (RFLP) methods to investigate the polymorphisms of 33 Y chromosome specific loci in 304 Chinese indigenous horses from 13 breeds. Consequently, two Y-single nucleotide polymorphisms (SNPs) (Y-45701/997 and Y-50869) and one Y-indel (Y-45288) were identified. Of those, the Y-50869 (T>A) revealed the highest variation frequency (24.6...
Pearce GP, May-Davis S, Greaves D.To investigate the occurrence of geometrical asymmetries in the macro-architecture of left and right femurs from Thoroughbred racehorses previously used in competitive training and racing in New South Wales, Australia. Methods: Detailed postmortem measurements were made of 37 characteristics of left and right femurs from eleven Thoroughbred racehorses euthanased for reasons unrelated to the study. Measurements focused on articulating surfaces and sites of attachment of muscles and ligaments known to be associated with hindlimb locomotion. Results: Five measurements were significantly larger in...
Yang G, Prestwich GD, Mann BK.The progression of wound healing is a complicated but well-known process involving many factors, yet there are few products on the market that enhance and accelerate wound healing. This is particularly problematic in veterinary medicine where multiple species must be treated and large animals heal slower, oftentimes with complicating factors such as the development of exuberant granulation tissue. In this study a crosslinked-hyaluronic-acid (HA-) based biomaterial was used to treat wounds on multiple species: rats, dogs, and horses. The base molecule, thiolated carboxymethyl HA, was first foun...
