Topic:Arabian Horses
Arabian horses are a distinct breed known for their endurance, intelligence, and distinctive physical characteristics, including a refined head shape and high tail carriage. Originating from the Arabian Peninsula, these horses have played a significant role in the development of various modern horse breeds. Their genetic makeup contributes to their unique attributes, which include a strong cardiovascular system and efficient energy metabolism, making them well-suited for long-distance riding and endurance competitions. This page aggregates peer-reviewed research studies and scholarly articles that explore the genetics, physiology, and performance attributes of Arabian horses, as well as their influence on other horse breeds and their role in equine sports and breeding programs.
Effects of endurance racing on horse plasma extracellular particle miRNA. Physical exercise is an essential factor in preventing and treating metabolic diseases by promoting systemic benefits throughout the body. The molecular factors involved in this process are poorly understood. Micro RNAs (miRNAs) are small non-coding RNAs that inhibit mRNA transcription. MiRNAs, which can participate in the benefits of exercise to health, circulate in plasma in extracellular particles (EP). Horses that undergo endurance racing are an excellent model to study the impact of long-duration/low intensity exercise in plasma EP miRNAs. Objective: To evaluate the effects of 160 km end...
Combining Threshold, Thurstonian and Classical Linear Models in Horse Genetic Evaluations for Endurance Competitions. The racing time and rank at finish traits are commonly used for endurance horse breeding programs as a measure of their performance. Even so, given the nature of endurance competitions, many horses do not finish the race. However, the exclusion of non placed horses from the dataset could have an influence on the prediction of individual breeding values. The objective of the present paper was to develop a multitrait model including race time (T), rank (R) and placing (P), with different methodologies, to improve the genetic evaluation in endurance competitions in Spain. The database contained 6...
Genome Diversity and the Origin of the Arabian Horse. The Arabian horse, one of the world's oldest breeds of any domesticated animal, is characterized by natural beauty, graceful movement, athletic endurance, and, as a result of its development in the arid Middle East, the ability to thrive in a hot, dry environment. Here we studied 378 Arabian horses from 12 countries using equine single nucleotide polymorphism (SNP) arrays and whole-genome re-sequencing to examine hypotheses about genomic diversity, population structure, and the relationship of the Arabian to other horse breeds. We identified a high degree of genetic variation and complex ances...
Unraveling the Genetics Behind Equid Cardiac Disease. There have been some advances in understanding the genetic contribution to ventricular septal defects in Arabians, sudden death in racehorses, and atrial fibrillation in racehorses. No genetic analyses have been published for aortic rupture in Friesians or atrioventricular block in donkeys despite strong evidence for a genetic cause. To date, no genetic mutation has been identified for any equid cardiac disease. With the advancement of genetic tools and resources, we are moving closer to discoveries that may explain the heritable basis of inherited equid cardiac disease.
Ultrasonography and Surgical Treatment of an Unusual Case of Urethral Calculus in an Arabian Horse. This case report records an obstructive urolithiasis due to a large calcium carbonate urethral stone in an 11-year-old Arabian stallion. The stallion had colicky pain, anuria, and reduction in food and water intakes. Palpation of the penis revealed rhythmic contractions of the urethra, a hard mass in the penile urethra at the level of the ischial arch, and a dilated urethra proximal to the mass. Rectal examination revealed a distended and turgid urinary bladder. Passing a urethral catheter revealed a complete urethral obstruction at the level of the ischial arch. Ultrasonography revealed a cal...
Morphological Characteristics of the Placenta and Umbilical Cord of Arabian Mares Foaling in the United Arab Emirates. A total of 127 normal placentas from Arabian mares resident in the United Arab Emirates were examined. The mean linear dimensions of the placenta were, on average, 84% of those previously recorded for the placentas of the Thoroughbred. Significant differences in the size of the allantochorion between primigravid and multiparous mares were seen only in the linear dimensions of the body portion. The pregnant horn was more commonly on the right than left side of the uterus (P = .01; 74/127; 58%). Cord attachment was primarily at the base of the two placental horns (112/127; 88%), with the remain...
Assessment of the FAM174A 11G allele as a risk allele for equine metabolic syndrome. An 11G nucleotide repeat in the 3' UTR of FAM174A was recently postulated as a risk allele with a dominant mode of inheritance for equine metabolic syndrome (EMS) and laminitis status in Arabian horses. The objective of this project was to evaluate this hypothesis in a large and diverse across-breed population. A total of 301 ponies, 292 Morgans, 64 Arabians, 49 Tennessee Walking Horses and 59 Quarter Horses were genotyped for six observed G repeat alleles in the FAM174A 3' UTR. Phenotype data included laminitis status, baseline insulin, glucose, non-esterified fatty acids, triglycerides, adip...
Novel Streptococcus equi strains causing strangles outbreaks in Arabian horses in Egypt. Strangles displays a major challenge to veterinary medicine worldwide. However, no data on Streptococcus equi subsp. equi (S. equi) M protein alleles have been reported so far from Arabian horses. We report here for the first time the S. equi SeM alleles causing strangles in Arabian horses, and the associated risk factors for the disease. Duplicate samples from one hundred Arabian horses with acute strangles in confirmed outbreaks and sporadic cases were analysed by phenotypic methods and multiplex polymerase chain reaction (PCR) targeting streptokinase precursor, seeI and sodA genes. PCR and ...
Use of autologous fascia lata graft to repair a complex corneal ulcer in a mare. Application of an autogenous fascia lata graft in the treatment of keratomalacia in the horse has not been reported. The present case describes the use of an autologous fascia lata graft to surgically treat a complicated corneal ulcer in a horse. Methods: A 12-year-old Arabian mare was admitted to Sharjah Equine Hospital with a history of right eye ulcerative keratitis of unknown duration. Following a week of aggressive medical treatment, the condition deteriorated and a keratectomy and pedicle conjunctival graft were performed. A week later, the conjunctival graft partially dehisced and the u...
Genetic Parameters and Inbreeding Effect of Morphological Traits in Sardinian Anglo Arab Horse. The purpose of this study was to estimate the heritability and genetic correlations of four biometric measurements and an overall score (OS) in the Sardinian Anglo-Arab horse (SAA); moreover, the effect of inbreeding on these traits was investigated. A dataset with 43,624 horses (27,052 females and 16,572 males) was provided by the Agricultural Research Agency of Sardinia (AGRIS). Cannon bone circumference (BC), chest girth (CG), shoulder length (SL), and withers height (WH) were measured on 6033 SAA horses born in Sardinia between 1967 and 2005; beside the measurements, an overall score (OS) ...
Equine pythiosis in Egypt: clinicopathological findings, detection, identification and genotyping of Pythium insidiosum. Equine pythiosis is an emerging, devastating disease that is hard to treat. The tumour-like nodular skin masses grow rapidly and the outcome is generally fatal, and thus early diagnosis and intervention are important. Objective: (i) To highlight the clinical, histological and haematological findings in pythiosis, and (ii) to evaluate the efficacy of direct sample multiplex-PCR targeting the single nucleotide polymorphisms within the ribosomal DNA region for detection and genotyping of Pythium insidiosum. Methods: Two hundred and twenty horses including 204 Arabian and 16 draft horses were surv...
Genes encoding equine β-lactoglobulin (LGB1 and LGB2): Polymorphism, expression, and impact on milk composition. β-lactoglobulin is one of the most abundant milk whey proteins in many mammal species, including the domestic horse. The aim of this study was to screen for polymorphism in the equine LGB1 and LGB2 gene sequences (all exons, introns, and 5'-flanking region) and to assess potential relationship of particular genotypes with gene expression levels (measured in milk somatic cells) and milk composition traits (protein, fat, lactose, and total β-lactoglobulin content). Direct DNA sequencing analysis was performed for twelve horse breeds: Polish Primitive Horse (PPH), Polish Coldblood Horse (PCH), ...
Whole genome detection of sequence and structural polymorphism in six diverse horses. The domesticated horse has played a unique role in human history, serving not just as a source of animal protein, but also as a catalyst for long-distance migration and military conquest. As a result, the horse developed unique physiological adaptations to meet the demands of both their climatic environment and their relationship with man. Completed in 2009, the first domesticated horse reference genome assembly (EquCab 2.0) produced most of the publicly available genetic variations annotations in this species. Yet, there are around 400 geographically and physiologically diverse breeds of hors...
The Oxidative Stress Markers of Horses-the Comparison with Other Animals and the Influence of Exercise and Disease. Diacron-reactive oxygen metabolite (d-ROM) and biological antioxidant potential (BAP) levels in the serum of horses were measured (ponies, = 15; thoroughbred, = 31; other full-sized horses, = 7). The mean d-ROM levels in horses were significantly higher ( < 0.001) than those in dairy cattle ( = 25) and dogs ( = 31). However, d-ROM levels in horses were lower than the standard levels reported in humans. When d-ROM and BAP levels were plotted graphically, the points for horses with a disease (ringbone in 1 Japanese sports horse, cellulitis in 1 thoroughbred, melanoma in 1 Lipizzaner) fell ...
Effects of acepromazine and xylazine on subjective and objective assessments of forelimb lameness. To facilitate lameness evaluation, sedatives such as xylazine and acepromazine are regularly used in the clinical setting, despite concerns that they may confound lameness assessment. Objective: The objective of this study was to determine the effect of low doses of acepromazine and xylazine on subjective and objective lameness assessment. Methods: Randomised, blinded, crossover study. Methods: Six horses with experimentally induced solar pain were evaluated over a 1-hour period after treatment with intravenous xylazine (0.1 or 0.2 mg/kg), intravenous acepromazine (0.02 or 0.04 mg/kg), intra...
Enterolithiasis in horses: analysis of 15 cases treated surgically in Saudi Arabia. The equine colic, which is caused by the presence of enteroliths that are most often found in the small or large colon, is typical for certain geographical regions (dry and hot climate). A diet rich in alfalfa is one of the highest risk factors. The earliest symptoms include weight loss and repeated episodes of colic pain. To present the results of operative treatment of 15 horses with enteroliths in Saudi Arabia. Methods: Fifteen purebred Arabian horses in Saudi Arabia, aged between 2 and 18 years, were treated. Decision about the surgery was based on clinical exam, ultrasound and rectal exa...
Plasma disposition of gabapentin after the intragastric administration of escalating doses to adult horses. In humans, gabapentin an analgesic, undergoes non-proportional pharmacokinetics which can alter efficacy. No information exists on the pharmacokinetics of dosages >20 mg/kg, escalating dosages or dose proportionality of gabapentin in horses. Objective: Gabapentin exposure in plasma would not increase proportionally relative to the dose in horses receiving dosages ≥20 mg/kg. To assess the plasma pharmacokinetics of gabapentin after nasogastric administration of gabapentin at dosages of 10 to 160 mg/kg in adult horses. Methods: Nine clinically healthy adult Arabian and Quarter Horses....
Evaluation of Return Rates to Races in Racehorses After Tendon Injuries: Lesion-Related Parameters. Metacarpal tendon diseases are important problems that may cause a decrease in performance and even may finish sport life in equine athletes. In this study, it was aimed to evaluate the ratio of return to races and the time of staying away from races and also to detect the prognostic value of ultrasonographic findings in Thoroughbred and Arabian racehorses with metacarpal flexor tendon injury or peritendonitis. Of 120 cases, 84 (70.0%) returned to races. Among these, 82.1% had tendonitis (69/84) and 17.9% peritendonitis (15/84). Among the cases being unable to return to races, 91.7% had tendon...
Serum acylcarnitine profile in endurance horses with and without metabolic dysfunction. Mitochondrial β-oxidation is essential in fat metabolism and can be monitored with blood acylcarnitine profiling, as partly degraded fatty acids accumulate as their carnitine esters. To guarantee continuous energy supply during long-distance exercise, endurance horses oxidise considerable amounts of fat in the mitochondrion. In endurance races over 80 km, glycogen depletion is evident in equine slow-twitch high oxidative muscle fibres and as a consequence, horses participating in endurance races over 80 km rely almost entirely on β-oxidation of fatty acids. This study investigated mitoch...
Season’s Effects on Some Clinical, Hematological Parameters and Blood Cortisol Level in Sedated Arabian Horses With Xylazine. Influence of heat or cold stress in sedated animals is unclear and requires further investigations. The present study aimed to evaluate the season's effects on some clinical, hematological parameters and blood cortisol level in sedated Arabian horses with xylazine. Therefore, seven Arabian horses were used to investigate heart and respiratory rates, and capillary refill time and serum cortisol level were recorded before (0) and at 5, 15, 60, and 180 minutes postsedation. Heparinized venous samples were collected before (0) and 3 hours postsedation for analysis of hematological analysis. Arte...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses. Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Acute-phase protein profile in horses subjected to different exercise protocols. High-intensity exercise can be associated with the occurrence of muscle injury, as well as the induction of an acute-phase response (APR). The present study aims to investigate the synthesis and profile of serum proteins in horses before and after participating in 2 different exercise protocols and to relate this profile to the presence or absence of muscular injury caused by exercise. Ten purebred Arabian (n = 5) and Criollo (n = 5) horses were subjected to 2 different tests on a treadmill, one consisting of short-duration and rapid-acceleration training (TRA) that was mostly anerobic and the...
Effect of inbreeding on the “Club Foot” disorder in Arabian Pureblood horses reared in Italy. "The Club Foot" (or "Mismatched Foot") is an acquired or congenital flexural deformity of the distal interphalangeal joint, caused by a shortening of the musculotendinous unit of the deep digital flexor tendon. The aim of this research was to detect the incidence of the disorder in Arabian Pureblood horses, attempting to understand its causes and to analyze a possible role of inbreeding in its expression. In this breed, in fact, the pathology is widespread because in the environment of origin, the rocky desert, a hard and almost goat's hoof is not disabling so the selection against this disord...
Breed and stallion effects on frozen-thawed semen in warmblood, light and quarter horses. The objectives of the present study were to analyze systematic effects on semen quality traits from fresh and frozen-thawed semen collected in and outside season. A total of 4,681 reports on semen traits of 121 stallions representing Arabian, Thoroughbred, Quarter Horse and four warmblood breeds used for artificial insemination at the Lower Saxon National stud Celle were edited for analysis of gel-free volume, sperm concentration, total number of sperm and total number of motile sperm in fresh semen and in frozen-thawed semen progressive motility, DNA fragmentation index and non-viable sperm. ...
Clinical, hematologic, hemostatic, and serum biochemical findings related to survival in Arabian horses with colic. The efficacy of clinical examinations, and hematologic, hemostatic, and serum biochemical assessments to determine appropriate early medical or surgical therapy in Arabian horses with colic have not been well-described. Objective: We aimed to evaluate clinical and hematologic findings, coagulation-fibrinolytic parameters, and organ dysfunction markers in association with survival in horses with colic. Methods: Seventeen Arabian horses with colic and ten healthy horses were enrolled. After clinical examinations, including heart rates (HRs), capillary refill times (CRTs), abdominal sounds, recta...
Additional Evidence for DDB2 T338M as a Genetic Risk Factor for Ocular Squamous Cell Carcinoma in Horses. Squamous cell carcinoma (SCC) is the most common periocular cancer in horses and the second most common tumor of the horse overall. A missense mutation in damage-specific DNA-binding protein 2 (DDB2, c.1012 C>T, p.Thr338Met) was previously found to be strongly associated with ocular SCC in Haflinger and Belgian horses, explaining 76% of cases across both breeds. To determine if this same variant in DDB2 contributes to risk for ocular SCC in the Arabian, Appaloosa, and Percheron breeds and to determine if the variant contributes to risk for oral or urogenital SCC, histologically confirmed SCC c...
The use of the SLC16A1 gene as a potential marker to predict race performance in Arabian horses. Arabian horses are commonly believed to be one of the oldest and the most popular horse breeds in the world, characterized by favourable stamina traits and exercise phenotypes. During intensive training, the rates of lactate production and utilization are critical to avoid muscle fatigue and a decrease in exercise performance. The key factor determining transmembrane lactate transport is the monocarboxylate transporter 1 protein coded for by the SLC16A1 gene. The aim of the present research was to identify polymorphisms in the coding sequence and UTRs in the equine SLC16A1 gene and to evaluate...
The Genetics of Racing Performance in Arabian Horses. Arabian horses are commonly believed to be one of the oldest and most influential horse breeds in the world. The high financial benefits obtained from races tend to search for genetic markers strongly correlated with the results achieved. To date, the modern approaches such as transcriptome, miRNAome, and metabolome analyses have been used to investigate the genetic background of racing performance as well as endurance capacity in Arabians. The analysis of polymorphisms at the genome level has also been applied to the detection of genetic variants associated with exercise phenotype in the Arab...
Anti-Inflammatory State in Arabian Horses Introduced to the Endurance Training. Development of an anti-inflammatory state during physical training has been postulated in both human and equine athletes, but it is not completely understood. The aim of this study was to investigate whether endurance training changes pro- and anti-inflammatory cytokine profiles within a 20-week training season in young inexperienced endurance horses. Nine Arabian horses were examined in this prospective 20-week follow-up study. Blood samples were analysed 5 times monthly, at rest and after training sessions. Routine haematological examinations were performed. Cytokine patterns including IL-1...
The Blood and Muscle Expression Pattern of the Equine TCAP Gene during the Race Track Training of Arabian Horses. Horse musculature has been shaped through evolution by environmental and human factors, which has resulted in several extraordinary adaptations to physical effort. Skeletal muscle plasticity results from the response to mechanical stimulation causing hypertrophy, where sarcomeres increase the muscle's cross-sectional area under the influence of contractile forces. The aim of the present study was the evaluation of transcript abundance of the telethonin () gene, which is a part of the sarcomere macromolecular mechanosensory complex in the gluteus medius muscle, and the whole blood of Arabian ho...