Electroencephalography (EEG) in horses is a non-invasive technique used to measure electrical activity in the brain. This method involves placing electrodes on the scalp to detect neural oscillations, providing insights into brain function and neurological health. EEG is utilized in equine research to study brain activity during various states such as sleep, anesthesia, and seizure disorders. It can also aid in understanding behavioral responses and cognitive processes in horses. This page compiles peer-reviewed research studies and scholarly articles that explore the application, methodology, and implications of electroencephalography in equine neurological assessments.
Bergeler J, Liske-Schmitz A, Schmitz T, de Camp NV.The First Night Effect is a phenomenon whereby sleep duration and quality are compromised in unfamiliar environments or situations. Horses are often transported to new locations, such as sporting events. We wanted to know if the First Night Effect is also detectable in horses in two different populations. To investigate this, we compared five horses from a professional sports horse barn that are regularly used in competitions, with six horses from a breeding barn, that are less frequently transferred to unfamiliar places. Despite the significant differences observed in electroencephalography (...
Itoh K, Kikumura N, Maeda T, Hirata S, Ringhofer M.Despite the long history of the horse-human bond, our understanding of the brain and mind of horses remains limited due to the lack of methods to investigate their brain functions. This study introduces a novel methodology for completely non-invasive, multi-channel recording of electroencephalography (EEG) and evoked potentials in awake horses to examine equine auditory cortical processing. The new approach utilizes specially designed brush-shaped active electrodes that facilitate stable signal acquisition through the hair coat by penetrating electrode pins and integrated pre-amplifiers. A 12-...
Vinardell T, Elestwani S, Jamieson C, Karim E, Robin M, Glynn S, Benini R, Aleman M.A standardized protocol for electroencephalography (EEG) under standing sedation for the investigation of epilepsy in foals is needed. Objective: To evaluate a modified standardized EEG protocol under standing sedation using sublingual detomidine hydrochloride in Egyptian Arabian foals. Methods: Nineteen foals (controls, 9; juvenile idiopathic epilepsy [JIE], 10). Methods: Descriptive clinical study. Foals were classified as controls or epileptic based on history or witnessed seizures and neurological examination. Foals were sedated using sublingual detomidine hydrochloride at a dosage of 0.08...
Murillo C, Weng HY, Weil AB, Kreuzer M, Ko JC.This study aimed to investigate the use of electroencephalography (EEG) for detecting brain activity changes perioperatively in anesthetized horses subjected to surgery. Twelve adult horses undergoing various surgeries were evaluated after premedication with xylazine and butorphanol, induction with ketamine, midazolam, and guaifenesin, and maintenance with isoflurane. The frontal EEG electrodes were placed after the horse was intubated and mechanically ventilated. The EEG data were collected continuously from Stage (S)1-transition from induction to isoflurane maintenance, S2-during surgery, S3...
Zanker A, Wöhr AC, Reese S, Erhard M.Veterinary and human medicine are still seeking a conclusive explanation of the function of sleep, including the change in sleep behaviour over the course of an individual's lifetime. In human medicine, sleep disorders and abnormalities in the electroencephalogram are used for prognostic statements, therapeutic means and diagnoses. To facilitate such use in foal medicine, we monitored 10 foals polysomnographically for 48 h. Via 10 attached cup electrodes, brain waves were recorded by electroencephalography, eye movements by electrooculography and muscle activity by electromyography. Wireless ...
Stomp M, d'Ingeo S, Henry S, Lesimple C, Cousillas H, Hausberger M.Assessing chronic pain is a challenge given its subjective dimension. In humans, resting state electroencephalography (EEG) is a promising tool although the results of various studies are contradictory. Spontaneous chronic pain is understudied in animals but could be of the highest interest for a comparative study. Riding horses show a very high prevalence of back disorders thought to be associated with chronic pain. Moreover, horses with known back problems show cognitive alterations, such as a lower attentional engagement. Therefore, we hypothesized that the individual EEG power profiles res...
Ma H, Lundy JD, Cottle EL, O'Malley KJ, Trichel AM, Klimstra WB, Hartman AL, Reed DS, Teichert T.Alphaviruses such as Venezuelan equine encephalitis virus (VEEV) and Eastern equine encephalitis virus (EEEV) are arboviruses that can cause severe zoonotic disease in humans. Both VEEV and EEEV are highly infectious when aerosolized and can be used as biological weapons. Vaccines and therapeutics are urgently needed, but efficacy determination requires animal models. The cynomolgus macaque (Macaca fascicularis) provides a relevant model of human disease, but questions remain whether vaccines or therapeutics can mitigate CNS infection or disease in this model. The documentation of alphavirus e...
de Camp NV, Ladwig-Wiegard M, Geitner CIE, Bergeler J, Thöne-Reineke C.As has been hypothesized more than 20 years ago, data derived from Electroencephalography (EEG) measurements can be used to distinguish between behavioral states associated with animal welfare. In our current study we found a high degree of correlation between the modulation index of phase related amplitude changes in the EEG of horses ( = 6 measurements with three different horses, mare and gelding) and their facial expression, measured by the use of the horse grimace scale. Furthermore, the pattern of phase amplitude coupling (PAC) was significantly different between a rest condition and a s...
Navarrete-Calvo R, Morgaz J, Gómez-Villamandos RJ, Quirós-Carmona S, Domínguez JM, Ruiz-López P, Granados MM.The bispectral index (BIS) has been evaluated as an indicator of central nervous system (CNS) depression in horses during general anaesthesia. The spectral entropy is another electroencephalographic device and it has not been evaluated yet in horses. Objective: To determine if spectral entropy can assess anaesthetic depth during the different phases of anaesthesia, define the value of state and response entropy during surgical plane of anaesthesia and compare them with BIS. Methods: Clinical, prospective, non-blinded observational study. Methods: Thirty-five horses ASA I or II undergoing sched...
Ruíz-López P, Domínguez JM, Granados MDM.To review monitors currently available for the assessment of nociception-antinociception in veterinary medicine. Methods: PubMed, Web of Science and Google Scholar. The results were initially filtered manually based on the title and the abstract. Conclusions: The provision of adequate antinociception is difficult to achieve in veterinary anaesthesia. Currently, heart rate and arterial blood pressure are used to monitor the response to a noxious stimulus during anaesthesia, with minimum alveolar concentration-sparing effect and stress-related hormones used for this purpose in research studies. ...
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Brain lateralization is a phenomenon widely reported in the animal kingdom and sensory laterality has been shown to be an indicator of the appraisal of the stimulus valence by an individual. This can prove a useful tool to investigate how animals perceive intra- or hetero-specific signals. The human-animal relationship provides an interesting framework for testing the impact of the valence of interactions on emotional memories. In the present study, we tested whether horses could associate individual human voices with past positive or negative experiences. Both behavioural and electroencephalo...
Rochais C, Sébilleau M, Menoret M, Oger M, Henry S, Hausberger M, Cousillas H.Lateralization of brain functions has been suggested to provide individuals with advantages, such as an increase of neural efficiency. The right hemisphere is likely to be specialized for processing attention for details and the left hemisphere for categorization of stimuli. Thus attentional processes actually may underlie lateralization. In the present study, we hypothesized that the attentional state of horses could be reflected in the lateralization of brain responses. We used i) a recently developed attention test to measure horses' visual attentional responses towards a standardized stimu...
Aleman M, Finno CJ, Weich K, Penedo MCT.The carrier status of lavender foal syndrome (LFS), cerebellar abiotrophy (CA), severe combined immunodeficiency (SCID), and occipitoatlantoaxial malformation (OAAM1) in foals with juvenile idiopathic epilepsy (JIE) is unknown. Objective: To determine the carrier status of LFS, CA, SCID, and OAAM1 in foals with JIE. Methods: Ten foals with JIE. Methods: Archived DNA samples were tested for known genetic mutations causing LFS, CA, SCID, and OAAM1. The inclusion criteria consisted of having been diagnosed with JIE by ruling out other causes of seizures in foals and supported by electroencephalog...
Cousillas H, Oger M, Rochais C, Pettoello C, Ménoret M, Henry S, Hausberger M.Electroencephalography (EEG) that has been extensively studied in humans presents also a large interest for studies on animal brain processes. However, since the quality of the recordings is altered by muscular activity, most EEG recordings on animals are obtained using invasive methods with deeply implanted electrodes. This requires anesthesia and can thus only be used in laboratory or clinical settings. As EEG is a very useful tool both for detecting brain alterations due to diseases or accidents and to evaluate the arousal and attentional state of the animal, it seemed crucial to develop a ...
Cho SH.The present study aimed to identify the effects of horseback riding and mechanical horseback riding exercise on the relative α-power spectrum in the elderly. A total of 31 healthy elderly were randomly divided into horseback riding (n=15) and mechanical horseback riding exercise groups (n=16). The horseback riding exercise program was conducted for 25min twice a week for 12 weeks. Two-way repeated analysis of variance was used to identify the changes in measured variables before the exercise program, and after 6 and 12 weeks of the program. The horseback riding exercise group showed an increa...
Johnson CB, Bloomfield M, Taylor PM.To characterise the effects of thiopentone on the equine electroencephalogram during halothane anaesthesia. Methods: Prospective controlled study. Methods: Eight healthy Welsh mountain pony geldings between 5 and 9 years old and weighing between 270 and 330 kg (mean 301 kg). Methods: Anaesthesia was induced with thiopentone and maintained using halothane in oxygen. End tidal halothane was maintained above 0.75 and below 0.85%. EEG was recorded continuously and a binaural broad band click stimulus was provided throughout the experiment at 6.1224 Hz. An infusion of 500 mg thiopentone was given o...
Johnson CB, Bloomfield M, Taylor PM.To identify and characterize the effects of guaiphenesin (GGE) on the electroencephalogram during halothane anaesthesia. Methods: Prospective controlled study. Methods: Eight healthy Welsh mountain pony geldings between 5 and 9 years old and weighing between 270 and 330 kg (mean 301 kg). Methods: Anaesthesia was induced with thiopentone and maintained using halothane in oxygen. End tidal halothane was maintained above 0.75 and below 0.85%. The EEG was recorded continuously and a binaural broad band click stimulus was provided throughout the experiment at 6.1224 Hz. An infusion of 1500 mg GGE w...
Tünsmeyer J, Hopster K, Kästner SB.To investigate the use of the Narcotrend electroencephalogram (EEG) monitor for the assessment of anesthetic depth in horses undergoing xylazine balanced isoflurane anesthesia. Methods: Blinded experimental study. Methods: Seven healthy warm-blooded horses, aged 10.6 ± 5.9 years, weighing 535 ± 55 kg. Methods: Horses were anesthetized for a terminal surgical trial with xylazine, thiopentone, and guaiphenesin for induction and isoflurane and xylazine continuous rate infusion for maintenance. After surgery, an EEG was recorded and processed by the Narcotrend monitor. It displays an...
Williams DC, Brosnan RJ, Fletcher DJ, Aleman M, Holliday TA, Tharp B, Kass PH, LeCouteur RA, Steffey EP.The effects of anesthesia on the equine electroencephalogram (EEG) after administration of various drugs for sedation, induction, and maintenance are known, but not that the effect of inhaled anesthetics alone for EEG recording. Objective: To determine the effects of isoflurane and halothane, administered as single agents at multiple levels, on the EEG and quantitative EEG (qEEG) of normal horses. Methods: Six healthy horses. Methods: Prospective study. Digital EEG with video and quantitative EEG (qEEG) were recorded after the administration of one of the 2 anesthetics, isoflurane or halothane...
Lacombe VA.Seizures are a diverse and very common set of chronic neurologic disorders in humans and dogs but are less common in horses. Seizures refer to a specific clinical event (described as sudden and severe) regardless of the etiology, which includes both intracranial and extracranial causes. Therefore, after briefly reviewing some definitions, this article aims to describe the use of a standardized classification, which could facilitate a logical approach for the clinician to establish a diagnosis, as well as to use a consistent mode of communication. For instance, seizures can be classified by typ...
Williams DC, Aleman MR, Brosnan RJ, Fletcher DJ, Holliday TA, Tharp B, Kass PH, Steffey EP, LeCouteur RA.Previous study of the diagnostic validity of electroencephalography (EEG) to detect abnormalities in equine cerebral cortical function relied on the administration of various drugs for sedation, induction, and maintenance of general anesthesia but used identical criteria to interpret recordings. Objective: To determine the effects of 2 inhalation anesthetics on the EEG of healthy horses. Methods: Six healthy horses. Methods: Prospective study. After the sole administration of one of either isoflurane or halothane at 1.2, 1.4, and 1.6 times the minimum alveolar concentration, EEG was recorded d...
Aleman M, Davis E, Williams DC, Madigan JE, Smith F, Guedes A.An intravenous (IV) overdose of pentobarbital sodium is the most commonly used method of euthanasia in veterinary medicine. However, this compound is not available in many countries or rural areas resulting in usage of alternative methods such as intrathecal lidocaine administration after IV anesthesia. Its safety and efficacy as a method of euthanasia have not been investigated in the horse. Objective: To investigate changes in mean arterial blood pressure and electrical activity of the cerebral cortex, brainstem, and heart during intrathecal administration of lidocaine. Our hypothesis was th...
Jang B, Song J, Kim J, Kim S, Lee J, Shin HY, Kwon JY, Kim YH, Joung YS.To investigate clinical effects of equine-assisted activities and therapy (EAA/T) for treating attention-deficit/hyperactivity disorder (ADHD) in children age 6-13 years. Methods: This 12-week, prospective, open-label trial included 24 sessions of EAA/T. Twenty participants (19 boys and 1 girl) completed 12 weeks of EAA/T. Various clinical tests were administered at baseline and after EAA/T. Assessments included the investigator-administered ADHD-Rating Scale (ARS-I), Clinical Global Impressions (CGI)-Severity Scale, Clinical Global Impressions-Improvement Scale (CGI-I), Gordon Diagnostic Syst...
Aleman M, Williams DC, Guedes A, Madigan JE.An overdose of pentobarbital sodium administered i.v. is the most commonly used method of euthanasia in veterinary medicine. Determining death after the infusion relies on the observation of physical variables. However, it is unknown when cortical electrical activity and brainstem function are lost in a sequence of events before death. Objective: To examine changes in the electrical activity of the cerebral cortex and brainstem during an overdose of pentobarbital sodium solution for euthanasia. Our testing hypothesis is that isoelectric pattern of the brain in support of brain death occurs bef...
Brain lateralization is a phenomenon widely reported in the animal kingdom and sensory laterality has been shown to be an indicator of the appraisal of the stimulus valence by an individual. This can prove a useful tool to investigate how animals perceive intra- or hetero-specific signals. The human-animal relationship provides an interesting framework for testing the impact of the valence of interactions on emotional memories. In the present study, we tested whether horses could associate individual human voices with past positive or negative experiences. Both behavioural and electroencephalo...
Ruíz-López P, Domínguez JM, Granados MDM.To review monitors currently available for the assessment of nociception-antinociception in veterinary medicine. Methods: PubMed, Web of Science and Google Scholar. The results were initially filtered manually based on the title and the abstract. Conclusions: The provision of adequate antinociception is difficult to achieve in veterinary anaesthesia. Currently, heart rate and arterial blood pressure are used to monitor the response to a noxious stimulus during anaesthesia, with minimum alveolar concentration-sparing effect and stress-related hormones used for this purpose in research studies. ...
Murrell JC, Johnson CB, White KL, Taylor PM, Haberham ZL, Waterman-Pearson AE.To identify changes in the amplitude spectrum of the electroencephalogram (EEG) during a standardized surgical model of nociception in horses. Methods: Thirteen entire male horses and ponies referred to Division of Clinical Veterinary Science, Bristol (n = 9) and Department of Clinical Veterinary Medicine (n = 4) for castration. Methods: Following pre-anaesthetic medication with acepromazine, anaesthesia was induced with guaiphenesin and thiopental and maintained with halothane in oxygen. The EEG was recorded continuously using subcutaneous needle electrodes. Additional monitoring comprised EC...
Williams DC, Aleman M, Holliday TA, Fletcher DJ, Tharp B, Kass PH, Steffey EP, LeCouteur RA.The influence of sleep on the equine electroencephalogram (EEG) has not been well documented. Objective: The objectives were to develop a noninvasive method of electrode placement for recording the EEG in horses and to establish normal EEG parameters for the various states of vigilance. Findings are compared with previously published reports on equine sleep based on electrocorticography (ECoG). Methods: Five neurologically normal horses. Methods: Overnight EEGs were recorded digitally in association with simultaneous videotaping of the horses' behavior. Data were analyzed by visual inspection,...
Haga HA, Dolvik NI.To evaluate Fourier-transformed electroencephalographic (EEG) variables, mean arterial blood pressure (MAP) and pulse rate as nociceptive indicators in isoflurane-anaesthetized horses. Methods: Five standardbred and three Norwegian cold-blooded trotter stallions undergoing castration, aged 2-4 years, mass 378-538 kg. Methods: All horses received intravenous (IV) detomidine (10 microg kg(-1) IV) and butorphanol (0.01 mg kg(-1) IV). Additional detomidine (4 microg kg(-1) IV) was administered in the induction area. Anaesthesia was induced with ketamine (2.5 mg kg(-1) IV) and diazepam (40 microg k...
Finno CJ, Higgins RJ, Aleman M, Ofri R, Hollingsworth SR, Bannasch DL, Reilly CM, Madigan JE.Equine degenerative myeloencephalopathy (EDM) is a neurodegenerative disorder that has been previously associated with low vitamin E concentrations. Objective: To describe the clinical, electrophysiologic, and pathologic features of EDM in a group of related Lusitano horses. Methods: Fifteen Lusitano horses. Methods: Neurologic examinations were conducted, and serum vitamin E concentrations were measured. Three neurologically abnormal horses were further evaluated by ophthalmologic examination, electroretinography, electroencephalography, muscle and nerve biopsies, and post-mortem examination....
Aleman M, Gray LC, Williams DC, Holliday TA, Madigan JE, LeCouteur RA, Magdesian KG.Epilepsy is relatively uncommon in horses compared with other species and limited information is available. Objective: The objectives of the study were to describe the age of onset, clinical signs, clinicopathologic data, electroeticephalographic findings, treatment, and outcome, including long-term prognosis in Arabian foals with idiopathic epilepsy. Methods: Twenty-two foals were included in the study. Methods: Medical records from 1985 to 2005 were reviewed. Results: The age of onset of affected foals ranged from 2 days to 6 months. Seizures were characterized by generalized tonic and cloni...
Dallaire A, Rucklebusch Y.For several weeks, three ponies kept in an environment with controlled light and temperature, were studied for behaviour (time spent in recumbency and time required to consume hay or oats) and for electrical activity of the brain (cortical and sub-cortical) during the night phase of the circadian rhythm. Recumbency was adopted by all the ponies for six or seven periods during the night. With a regimen of hay ad libitum, about four hours were cumulated in sternal recumbency and only one hour in complete lateral recumbency. Various degree of sleep, as identified by cortical and hippocampal elect...
Williams DC, Aleman M, Tharp B, Fletcher DJ, Kass PH, Steffey EP, LeCouteur RA, Holliday TA.The administration of certain sedatives has been shown to promote sleep in humans. Related agents induce sleep-like behavior when administered to horses. Interpretation of electroencephalograms (EEGs) obtained from sedated horses should take into account background activity, presence of sleep-related EEG events, and the animal's behavior. Objective: Sedatives induce states of vigilance that are indistinguishable on EEGs from those that occur naturally. Methods: Six healthy horses. Methods: Digital EEG with video was recorded after administration of 1 of 4 sedatives (acepromazine, butorphanol, ...
Johnson CB, Taylor PM.We have investigated in eight ponies the effects of three different end-tidal concentrations of halothane, isoflurane and methoxyflurane on median (F50) and 95% spectral edge (F95) frequencies of the EEG and the second differential (DD) of the middle latency auditory evoked potential (MLAEP). The three concentrations of each agent were chosen to represent approximately the minimum alveolar concentration (MAC), 1.25 MAC and 1.5 MAC for each agent. During halothane anaesthesia, F95 decreased progressively as halothane concentration increased, from mean 13.9 (SD 2.6) at 0.8% to 11.9 (1.1) at 1.2%...
Cho SH.The present study aimed to identify the effects of horseback riding and mechanical horseback riding exercise on the relative α-power spectrum in the elderly. A total of 31 healthy elderly were randomly divided into horseback riding (n=15) and mechanical horseback riding exercise groups (n=16). The horseback riding exercise program was conducted for 25min twice a week for 12 weeks. Two-way repeated analysis of variance was used to identify the changes in measured variables before the exercise program, and after 6 and 12 weeks of the program. The horseback riding exercise group showed an increa...
Jang B, Song J, Kim J, Kim S, Lee J, Shin HY, Kwon JY, Kim YH, Joung YS.To investigate clinical effects of equine-assisted activities and therapy (EAA/T) for treating attention-deficit/hyperactivity disorder (ADHD) in children age 6-13 years. Methods: This 12-week, prospective, open-label trial included 24 sessions of EAA/T. Twenty participants (19 boys and 1 girl) completed 12 weeks of EAA/T. Various clinical tests were administered at baseline and after EAA/T. Assessments included the investigator-administered ADHD-Rating Scale (ARS-I), Clinical Global Impressions (CGI)-Severity Scale, Clinical Global Impressions-Improvement Scale (CGI-I), Gordon Diagnostic Syst...
Lacombe VA, Mayes M, Mosseri S, Reed SM, Fenner WR, Ou HT.In contrast with reports in man and small animals, a systematic classification of seizures in horses is lacking. Objective: The purpose of this study was to classify seizures based on their aetiology and to characterise epilepsy in 104 horses presented for seizures at the Ohio State University Veterinary Medical Center between 1988 and 2009. Methods: In a retrospective observational study, seizures were classified by aetiology based on history, clinical observations, diagnostic investigations (e.g. electroencephalograms, cerebrospinal fluid and computed tomography imaging of the head) and post...
Cousillas H, Oger M, Rochais C, Pettoello C, Ménoret M, Henry S, Hausberger M.Electroencephalography (EEG) that has been extensively studied in humans presents also a large interest for studies on animal brain processes. However, since the quality of the recordings is altered by muscular activity, most EEG recordings on animals are obtained using invasive methods with deeply implanted electrodes. This requires anesthesia and can thus only be used in laboratory or clinical settings. As EEG is a very useful tool both for detecting brain alterations due to diseases or accidents and to evaluate the arousal and attentional state of the animal, it seemed crucial to develop a ...
Haga HA, Dolvik NI.To determine whether the bispectral index (BIS) can be used as an indicator of degree of CNS depression in isoflurane-anesthetized horses. Methods: 10 Standardbred and 6 Norwegian cold-blooded trotter stallions admitted for routine castration. Methods: A 2-channel referential electrode configuration was used to record EEG for calculation of BIS by the EEG monitor. The BIS was calculated before (awake) and after (sedated) administration of detomidine (0.01 mg/kg of body weight, IV) and butorphanol (0.01 mg/kg, IV). Anesthesia was induced with ketamine hydrochloride (2.5 mg/kg, IV) and diazepam ...
Purohit RC, Mysinger PW, Redding RW.A continuous series of electroencephalograms (EEG) was obtained from each of 6 mature horses which had been given xylazine and ketamine hydrochloride IV. Electrocardiograms and respiratory rates were also obtained. The EEG of the unsedated standing adult horse displayed a dominant fast activity in the range of 25-35 Hz, 5-30 microV superimposed over slower 1-4 Hz, 10-50 microV activity with occasional 10-14 Hz, 10-40 microV spindle-type activity. The xylazine-sedated horse displayed hypersynchronous EEG patterns, with the dominant activity being 1-3 Hz, 10-70 microV with overlying mixed freque...
Williams DC, Aleman MR, Brosnan RJ, Fletcher DJ, Holliday TA, Tharp B, Kass PH, Steffey EP, LeCouteur RA.Previous study of the diagnostic validity of electroencephalography (EEG) to detect abnormalities in equine cerebral cortical function relied on the administration of various drugs for sedation, induction, and maintenance of general anesthesia but used identical criteria to interpret recordings. Objective: To determine the effects of 2 inhalation anesthetics on the EEG of healthy horses. Methods: Six healthy horses. Methods: Prospective study. After the sole administration of one of either isoflurane or halothane at 1.2, 1.4, and 1.6 times the minimum alveolar concentration, EEG was recorded d...
Murrell JC, White KL, Johnson CB, Taylor PM, Doherty TJ, Waterman-Pearson AE.To record the electroencephalographic changes during castration in ponies anaesthetized with halothane and given intravenous (IV) lidocaine by infusion. The hypothesis tested was that in ponies, IV lidocaine is antinociceptive and would therefore obtund EEG changes during castration. Methods: Ten Welsh mountain ponies referred to the Department of Clinical Veterinary Medicine, Cambridge for castration under general anaesthesia. Methods: Following pre-anaesthetic medication with intramuscular acepromazine (0.02 mg kg(-1)) anaesthesia was induced with IV guaiphenesin (60 mg kg(-1)) and thiopenta...
Mysinger PW, Redding RW, Vaughan JT, Purohit RC, Holladay JA.To establish a clinically practical procedure for recording the equine EEG, 25 healthy adult horses and 6 newborn foals were used. Recordings were taken with the animals alert and tranquilized, confined in metal stocks, or physically restrained. The dominant alert waveforms of adult horses were fast activity (25 to 40 Hz) with medium-to-low voltages (5 to 40 microV-dominant 10 to 15 microV). Underlying this fast activity was slower (0.5 to 4.0 Hz) activity with medium-to-low voltages (10 to 40 microV). Twelve of the 25 adult horses had EEG frequencies in the alpha frequency range (10 to 15 Hz,...
Williams DC, Brosnan RJ, Fletcher DJ, Aleman M, Holliday TA, Tharp B, Kass PH, LeCouteur RA, Steffey EP.The effects of anesthesia on the equine electroencephalogram (EEG) after administration of various drugs for sedation, induction, and maintenance are known, but not that the effect of inhaled anesthetics alone for EEG recording. Objective: To determine the effects of isoflurane and halothane, administered as single agents at multiple levels, on the EEG and quantitative EEG (qEEG) of normal horses. Methods: Six healthy horses. Methods: Prospective study. Digital EEG with video and quantitative EEG (qEEG) were recorded after the administration of one of the 2 anesthetics, isoflurane or halothane...
Aleman M, Williams DC, Guedes A, Madigan JE.An overdose of pentobarbital sodium administered i.v. is the most commonly used method of euthanasia in veterinary medicine. Determining death after the infusion relies on the observation of physical variables. However, it is unknown when cortical electrical activity and brainstem function are lost in a sequence of events before death. Objective: To examine changes in the electrical activity of the cerebral cortex and brainstem during an overdose of pentobarbital sodium solution for euthanasia. Our testing hypothesis is that isoelectric pattern of the brain in support of brain death occurs bef...
Rochais C, Sébilleau M, Menoret M, Oger M, Henry S, Hausberger M, Cousillas H.Lateralization of brain functions has been suggested to provide individuals with advantages, such as an increase of neural efficiency. The right hemisphere is likely to be specialized for processing attention for details and the left hemisphere for categorization of stimuli. Thus attentional processes actually may underlie lateralization. In the present study, we hypothesized that the attentional state of horses could be reflected in the lateralization of brain responses. We used i) a recently developed attention test to measure horses' visual attentional responses towards a standardized stimu...
Ma H, Lundy JD, Cottle EL, O'Malley KJ, Trichel AM, Klimstra WB, Hartman AL, Reed DS, Teichert T.Alphaviruses such as Venezuelan equine encephalitis virus (VEEV) and Eastern equine encephalitis virus (EEEV) are arboviruses that can cause severe zoonotic disease in humans. Both VEEV and EEEV are highly infectious when aerosolized and can be used as biological weapons. Vaccines and therapeutics are urgently needed, but efficacy determination requires animal models. The cynomolgus macaque (Macaca fascicularis) provides a relevant model of human disease, but questions remain whether vaccines or therapeutics can mitigate CNS infection or disease in this model. The documentation of alphavirus e...
Lacombe VA, Podell M, Furr M, Reed SM, Oglesbee MJ, Hinchcliff KW, Kohn CW.Electroencephalography (EEG) is a valuable diagnostic test to identify functional disturbances in brain activity. The purpose of this study was to assess the validity of EEG as a diagnostic indicator of intracranial diseases in horses. The validity of EEG was estimated by comparing clinical, clinicopathologic, and histopathologic findings to EEG findings in 20 horses examined for seizures. collapse, or abnormal behavior between 1984 and 1997. A bipolar left-to-right, back-to-front montage and a bipolar circular montage were recorded from sedated (4) and anesthetized (16) horses. Visual and sem...
Ekström PM, Short CE, Geimer TR.This study was done to compare the electroencephalographic (EEG) response evoked by orthopedic surgery in halothane- and isoflurane-anesthetized horses. Eight horses scheduled for bilateral arthroscopic surgery of the stifle were premedicated with detomidine (20 micrograms/kg) intravenously and five minutes later induced to anesthesia with ketamine (2.2 mg/kg) intravenously. Anesthesia was maintained with either halothane or isoflurane. Assignment of inhalation anesthetic was done randomly. The multiple of minimal alveolar concentration (MAC) of halothane required for anesthesia was significan...
Otto K, Short CE.Electroencephalographic (EEG) power spectrum analysis was performed in 18 conscious, adult horses for evaluation as control values for EEG data obtained during anesthesia. Computer-processed total amplitudes for the frequency range 0 to 32 Hz were mainly between 400 and 600 microV, with 80% spectral edge frequency between 16.6 and 32.5 Hz. The highest electrical activity was in the delta band (41.3 +/- 4.4% of total amplitude); there was a less pronounced activity in the beta (34.2 +/- 5.2%), theta (13.6 +/- 1.5%), and alpha (10.0 +/- 1.0%) bands. The applicability of EEG power spectrum analys...
Wijnberg ID, van der Ree M, van Someren P.Short-duration electroencephalography (EEG) recordings in horses are helpful in diagnosing intracranial disorders. Potentially, long-duration ambulatory EEG (AEEG) recordings in horses will enhance the chance of detecting abnormal brain activity independent of the presence of an insult. Objective: The objective of this study was to test if AEEG recordings in unsedated horses can be acquired and benefit diagnosing abnormal brain activity. Methods: Recordings were taken from 8 adult control horses and 10 patients suspected of intracranial abnormalities. Self-adhesive electrodes and the 'Porti-5'...
Tünsmeyer J, Hopster K, Kästner SB.To investigate the use of the Narcotrend electroencephalogram (EEG) monitor for the assessment of anesthetic depth in horses undergoing xylazine balanced isoflurane anesthesia. Methods: Blinded experimental study. Methods: Seven healthy warm-blooded horses, aged 10.6 ± 5.9 years, weighing 535 ± 55 kg. Methods: Horses were anesthetized for a terminal surgical trial with xylazine, thiopentone, and guaiphenesin for induction and isoflurane and xylazine continuous rate infusion for maintenance. After surgery, an EEG was recorded and processed by the Narcotrend monitor. It displays an...
Aleman M, Davis E, Williams DC, Madigan JE, Smith F, Guedes A.An intravenous (IV) overdose of pentobarbital sodium is the most commonly used method of euthanasia in veterinary medicine. However, this compound is not available in many countries or rural areas resulting in usage of alternative methods such as intrathecal lidocaine administration after IV anesthesia. Its safety and efficacy as a method of euthanasia have not been investigated in the horse. Objective: To investigate changes in mean arterial blood pressure and electrical activity of the cerebral cortex, brainstem, and heart during intrathecal administration of lidocaine. Our hypothesis was th...
de Camp NV, Ladwig-Wiegard M, Geitner CIE, Bergeler J, Thöne-Reineke C.As has been hypothesized more than 20 years ago, data derived from Electroencephalography (EEG) measurements can be used to distinguish between behavioral states associated with animal welfare. In our current study we found a high degree of correlation between the modulation index of phase related amplitude changes in the EEG of horses ( = 6 measurements with three different horses, mare and gelding) and their facial expression, measured by the use of the horse grimace scale. Furthermore, the pattern of phase amplitude coupling (PAC) was significantly different between a rest condition and a s...