Equine health encompasses the study and management of diseases, disorders, and overall well-being of horses. It involves understanding various physiological systems, preventive care, and treatment strategies to maintain optimal health in equine populations. Common areas of focus include nutrition, infectious diseases, orthopedic conditions, and reproductive health. Research in equine health aims to advance knowledge on diagnostic methods, therapeutic interventions, and management practices that improve horse welfare and performance. This page collects peer-reviewed research studies and scholarly articles that explore the diverse aspects of equine health, offering insights into current findings and advancements in the field.
Pesch S, Bostedt H, Failing K, Bergmann M.Routine semen analysis of stallions is based on light microscopy (LM). However, there are still a number of animals that are subfertile or even infertile not being identified with conventional semen analysis. The objective of this study was to investigate the suitability of transmission electron microscopy (TEM) for advanced fertility diagnosis in stallion. We examined ejaculates of 46 stallions with known fertility. Animals were divided into three different groups: group 1, fertile stallions (pregnant mares> or =70%, n=29); group 2, subfertile stallions (pregnant mares 10-69%, n=14); group 3,...
Lugo J, Harkema JR, deFeijter-Rupp H, Bartner L, Boruta D, Robinson NE.This study was performed to determine if a peripheral sample of lung from the site where biopsy is conducted is representative of the rest of the lung and to investigate the relationship between airway inflammation and intraepithelial mucous production in the peripheral airways. Lung parenchyma samples were collected from five different regions of the lung in five control and five heaves-affected horses. Horse groups were defined by clinical response to stabling. Tissue sections were used for semi-quantitative scoring of lesions, to count the number of airways, to quantify the amount of stored...
Soma LR, Uboh CE, Guan F, Luo Y, Moate PJ, Boston RC, Driessen B.Hemoglobin-glutamer-200 (HBOC-200) is a hemoglobin (Hb)-based oxygen carrier (HBOC) comprising glutaraldehyde-polymerized bovine Hb. In this study, we sought to determine the pharmacokinetics of this first generation HBOC after IV infusion of 32.5 g of HBOC-200 solution in horses. Quantification of HBOC-200 in equine plasma and urine was performed using a method recently developed by our laboratory. The elimination from plasma was based on size distribution of the bovine Hb polymer. The decline of plasma concentration-time curve of HBOC-200 was described by a noninterchanging 2-compartmental m...
Paillot R, Daly JM, Juillard V, Minke JM, Hannant D, Kydd JH.Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to...
Young LE, Rogers K, Wood JL.Cardiac morphology in human athletes is known to differ, depending on the sports-specific endurance component of their events, whereas anecdotes abound about superlative athletes with large hearts. As the heart determines stroke volume and maximum O(2) uptake in mammals, we undertook a study to test the hypothesis that the morphology of the equine heart would differ between trained horses, depending on race type, and that left ventricular size would be greatest in elite performers. Echocardiography was performed in 482 race-fit Thoroughbreds engaged in either flat (1,000-2,500 m) or jump racin...
Moore AI, Squires EL, Graham JK.Seminal plasma is generally removed from equine spermatozoa prior to cryopreservation. Two experiments were designed to determine if adding seminal plasma back to spermatozoa, prior to cryopreservation, would benefit the spermatozoa. Experiment 1 determined if different concentrations of seminal plasma affected post-thaw sperm motility, viability and acrosomal integrity of frozen/thawed stallion spermatozoa. Semen was washed through 15% Percoll to remove seminal plasma and spermatozoa resuspended to 350 x 10(6)sperm/mL in a clear Hepes buffered diluent containing either 0, 5, 10, 20, 40 or 80%...
Rohrbach BW, Ward DA, Hendrix DV, Cawrse-Foss M, Moyers TD.To evaluate the effect of vaccination against leptospirosis on frequency and days to recurrence of uveitis and progression of disease in horses with equine recurrent uveitis (ERU). Methods: Forty-one horses with ERU. Methods: Horses were randomly assigned to experimental (vaccinated) or control groups. Vaccine containing six serovars of Leptospira or placebo was administered, an ophthalmic examination performed and blood samples drawn on days 0, 28, 180 and 365. Antibody titers were measured against each serovar. Recurrence of uveitis was verified by ophthalmic examination. Results of the init...
Kaps S, Richter M, Philipp M, Bart M, Eule C, Spiess BM.A 12-year-old Haflinger gelding was presented to the veterinary medical teaching hospital of the University of Zurich with a light-pink raised mass on the temporal limbus and conjunctiva of the left eye. Squamous cell carcinoma was confirmed histologically after keratectomy and cryotherapy. Seven months later, a smooth pink, progressively enlarging mass was observed within the cornea of the left eye. Ultrasonographically, the mass was not only infiltrating the corneal stroma but seemed to protrude into the anterior chamber. The globe was surgically removed and submitted for pathology. A histol...
Almeida J, Ball BA.The objective of this study was to compare the effect of alpha-tocopherol and its ester, alpha tocopherol succinate, on lipid peroxidation and motility of equine spermatozoa. In experiment one, spermatozoa were incubated with dl-alpha-tocopherol (5, 25, 100 or 500 microM), DL-alpha tocopherol succinate (5, 25, 100 or 500 microM) or vehicle (0.5% ethanol) at 38 degrees C, and sperm motility was determined at 30, 60 and 120 min. In experiment two, spermatozoa loaded with the lipophilic probe, C11BODIPY(581/591), were incubated with dl-alpha-tocopherol (50 and 100 microM), DL-alpha-tocopherol suc...
Zapata GL, Britos RM, Pintos ME, Dreizzen E, Lausada NB, Arauz S.The objective of this paper was to determine the physiological values of urea nitrogen and creatinine in tears, and to compare the results with those obtained from serum. Thirty healthy thoroughbred horses were included in the study. Tear fluid samples were obtained using a glass capillary tube placed in lower conjunctival cul-de-sac. Blood samples were taken from the jugular vein. Tear and serum urea nitrogen and creatinine levels were quantitatively analyzed by an enzymatic colorimetric method. Urea nitrogen values were 4.22+/-1.84 mmol/l in tears and 4.44+/-1.78 mmol/l in serum, whereas cre...
Takafuji VA, Howard RD, Ward DL, Sharova LV, Crisman MV.The effect of recombinant equine IL-1beta (EqIL-1beta) on steady-state mRNA levels of equine articular chondrocytes in high-density monolayer culture was investigated using a customized cDNA array analysis. Total RNA samples isolated from chondrocytes cultured in media alone or with the addition of 1 ng/ml EqIL-1beta for 1-, 3-, and 6-h durations of exposure were reverse transcribed, radiolabeled, and hybridized to a customized 380-target cDNA array. Means of duplicate log base 2 transformed hybridization signals were normalized to equine glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mean s...
Hodgson D, Howe S, Jeffcott L, Reid S, Mellor D, Higgins A.Oral administration of altrenogest for oestrus suppression in competition horses is believed to be widespread in some equestrian disciplines, and can be administered continuously for several months during a competition season. To examine whether altrenogest has any anabolic or other potential performance enhancing properties that may give a horse an unfair advantage, we examined the effect of oral altrenogest (0.044 mg/kg), given daily for a period of eight weeks, on social hierarchy, activity budget, body-mass and body condition score of 12 sedentary mares. It was concluded that prolonged ora...
Smith MA, Edwards GB, Dallap BL, Cripps PJ, Proudman CJ.The objectives of the study were to determine whether retrospective data can be used to answer questions about the efficacy of prokinetic agents when used to treat horses with post-operative ileus (POI). We describe prevalence and mortality of POI with reference to treatment with four prokinetic agents. By combining data from two Hospitals a study population of 55 horses with POI following pedunculated lipoma obstruction (PLO) was established. Univariable and multivariable associations were determined between short term survival and potential explanatory variables. With death as outcome in mul...
Davies HM, Watson KM.The aims of this study were to test whether longer third metacarpal (MC3) bones had thicker dorsal cortices in a group of racehorses that were exercising at similar maximum speeds, and to establish if horses with larger differences in length between their right and left MC3 bones showed larger differences in the dorsal cortical thickness between the two limbs. Methods: An observational study. Methods: Forty Thoroughbred racehorses aged between 2 and 6 years and in training at racing speed at two racing stables were used. Two sets of radiographs of each left and right metacarpus of each horse w...
Moussa M, Bersinger I, Doligez P, Guignot F, Duchamp G, Vidament M, Mermillod P, Bruyas JF.Vitrification using open pulled straw (OPS) has provided encouraging results with embryos from other species. The aim of this study was to compare the survival of 6.5- and 6.75-day-old equine embryos after OPS vitrification and slow-cooling. Eighteen embryos were frozen using a slow-cooling method. Embryos were placed in modified PBS with increasing glycerol concentration (2.5%, 5%, 7.5% and 10% (v/v) 5 min each). Embryos were loaded into 0.25 ml straws then placed in a programmable freezer and subsequently plunged into liquid nitrogen. After thawing, cryoprotectant was removed by five steps w...
Dabareiner RM, Cohen ND, Carter GK, Nunn S, Moyer W.To determine the types of musculoskeletal problems that result in lameness or poor performance in horses used for team roping and determine whether these problems are different in horses used for heading versus heeling. Methods: Retrospective study. Methods: 118 horses. Methods: Medical records of team roping horses that were evaluated because of lameness or poor performance were reviewed to obtain information regarding signalment, primary use (ie, head horse or heel horse), history, results of physical and lameness examinations, diagnostic tests performed, final diagnosis, and treatment. Resu...
Da Costa Gómez TM, Barrett JG, Sample SJ, Radtke CL, Kalscheur VL, Lu Y, Markel MD, Santschi EM, Scollay MC, Muir P.Functional adaptation of bone normally protects the skeleton from fracture during daily activity. Accumulation of microcracking and loss of osteocytes have been implicated in the regulation and initiation of targeted (reparative) remodeling of bone and, in certain situations, the development of fatigue or stress fracture. We performed a histologic study of the dorsal cortex of the mid-diaphysis of the third metacarpal (Mc-III) bone of Thoroughbred racehorses after bones were bulk-stained in basic fuchsin and transverse calcified sections were prepared. The Thoroughbred racehorse is an extreme ...
Ohlsson J, Jansson N.To determine the success rate and whether specific patient and treatment factors influenced the outcome after conservative treatment with a bar shoe with quarter clips of intra-articular fractures of the distal phalanx in horses not used for racing. Methods: Retrospective study. Methods: Thirty-two client-owned horses. Methods: Hospital records of horses that had been treated conservatively for intra-articular fractures of the distal phalanx at Skara Equine Hospital or Halland Animal Hospital in Sweden between 1995 and 2001 were reviewed. Racehorses in active training and horses affected with ...
Rambags BP, Stout TA.An 18-year-old Friesian mare with a large intrauterine cyst was examined by transrectal ultrasonography. There were several small to moderately sized intraluminal endometrial cysts, one of which connected via the myometrium to a large subserosal cyst, thereby effectively forming a 'transmural' cyst complex. During a videohysteroscopy, the intraluminal part of this transmural cyst was removed by electrocoagulation via a polypectomy snare. It was then possible to drain the large subserosal part of the cyst into the uterine lumen by transrectal massage, thereby confirming the presence of the tran...
McClure SR, White GW, Sifferman RL, Bernard W, Hughes FE, Holste JE, Fleishman C, Alva R, Cramer LG.To determine whether omeprazole oral paste administered at a dosage of 0.5 or 1 mg/kg (0.23 or 0.45 mg/lb), PO, every 24 hours would effectively prevent the recurrence of gastric ulcers in horses in race training. Methods: Prospective study. Methods: 135 horses. Methods: Horses with gastric ulcers were treated with omeprazole at a dosage of 4 mg/kg (1.8 mg/lb), PO, every 24 hours for 28 days. Horses in the dose selection portion of the study were sham dose treated or received 0.5 or 1 mg of omeprazole/kg, PO, every 24 hours for an additional 28 days. Horses in the dose confirmation portion of ...
De Clercq D, van Loon G, Baert K, Tavernier R, Croubels S, De Backer P, Deprez P.Six horses without underlying cardiac disease were presented because of atrial fibrillation of between 5 and 12 months duration. These horses received an intravenous amiodarone treatment of 5mg/kg/h for 1 h followed by 0.83mg/kg/h for 23h and subsequently 1.9mg/kg/h for 30h. During treatment, clinical signs were monitored and a surface ECG and an intra-atrial electrogram were recorded. Infusion was discontinued when sinus rhythm or side effects occurred. Four horses successfully cardioverted, of which one showed symptoms of hind limb weakness and weight shifting. Two horses did not cardiovert ...
Grogan EH, McDonnell SM.To evaluate behavioral compliance of horses and ponies with simulated intranasal vaccination and assess development of generalized aversion to veterinary manipulations. Methods: Clinical trial. Methods: 28 light horse mares, 3 pony geldings, 2 light horse stallions, and 3 pony stallions that had a history of compliance with veterinary procedures. Methods: Behavioral compliance with 2 intranasal vaccine applicators was assessed. Compliance with standard physical examination procedures was assessed before and after a single experience with either of the applicators or a control manipulation to e...
The measurement of cell proliferation and cell viability using 5'bromo-2'deoxy-uridine (BrdU) labelling has been described in several cell types and species. The aim of this study was to adapt this technique to equine embryos and to compare the index of DNA replication (S-phase) between equine and caprine embryos. Seventeen equine embryos were recovered at day 6.5 post-ovulation and 20 caprine embryos were recovered at day 7 after the onset of estrus. Equine embryos were incubated during 1h at 39 degrees C in PBS containing 1mM of BrdU. Embryos were then treated in 0.05% trypsin during 15 min ...
Meana A, Pato NF, Martín R, Mateos A, Pérez-García J, Luzón M.An epidemiological study on equine cestodosis was carried out in central Spain. A total of 372 digestive tracts from equids slaughtered in abattoirs located in central Spain were studied from November 2001 to May 2004. Anoplocephala perfoliata was detected in 24% of the animals and Anoplocephala magna in 18%. Individual tapeworm burden was from 1 to 491 tapeworms for A. perfoliata and from 1 to 64 tapeworms for A. magna. Low tapeworm burdens (less than 30 cestodes) predominated significantly (p<0.01) in all seasons for both species. Seasonal prevalence of infection by A. perfoliata was signifi...
Trim CM, Eaton SA, Parks AH.An 8-year-old Thoroughbred gelding with colic was anesthetized for surgical correction of right dorsal displacement of the ascending colon. Removal of the nasogastric tube at the end of surgery resulted in hemorrhage from the nares and loss of 24 L of blood. Treatment included administration of acetated Ringer's solution, hypertonic saline solution, and dobutamine. A blood transfusion was started after hemorrhage was controlled, and arterial pressure was restored to the prehemorrhage value, but was stopped after infusion of 2.7 L of blood because of a suspected adverse reaction. This case indi...
Dyson SJ.Desmitis of the accessory ligament of the deep digital flexor tendon (ALDDFT) was diagnosed in 27 horses between September 1986 and December 1990. The first observed clinical sign in four horses was localised swelling in the proximal metacarpus. Twenty horses became lame suddenly during a work period and most developed swelling within 24 h of exercise. The injury was confirmed by ultrasonographic examination. Ten of 13 horses with uncomplicated desmitis of the ALDDFT resumed full work, within three to nine months of the onset of clinical signs, without recurrence of clinical signs in the perio...
Lamas LP, Edmonds J, Hodge W, Zamora-Vera L, Burford J, Coomer R, Munroe G.REASONS FOR PERFORMING THIS STUDY: Intra-articular ethanol has been described to promote distal tarsal joint ankylosis. Its use and results in clinical cases affected by osteoarthritis (OA) have not been reported. Objective: To describe and evaluate the results of treatment of distal tarsal joint OA by facilitated ankylosis stimulated by intra-articular ethanol injection. Methods: Twenty-four horses met the inclusion criteria of tarsometatarsal and centrodistal joint OA diagnosed by a positive response to intra-articular analgesia, radiographic evaluation and recurrence of lameness ≤ 4 month...
de Linde Henriksen M, Andersen PH, Mietelka K, Farina L, Thomsen PD, Plummer CE, Mangan BG, Heegaard S, Coleman JK, Toft N, Brooks DE.To investigate histopathologic and immunohistochemical aspects of equine deep stromal abscesses (DSA) with a focus on the histopathologic diagnosis, presumptive etiology, and the immunohistochemical expression of three angiogenesis-related factors: vascular endothelial growth factor-A (VEGF-A), pigment epithelium-derived factor (PEDF), and interleukin-1 receptor antagonist (IL-1ra). Methods: Paraffin-embedded biopsy samples from 51 DSA. The biopsies were collected from full-thickness penetrating keratoplasty or split-thickness lamellar keratoplasty surgeries at the University of Florida Veteri...
Christensen BW, Roberts JF, Pozor MA, Giguere S, Sells SF, Donahue JM.A 4-year-old Thoroughbred mare was evaluated because of placental abnormalities and a retained placental remnant. Results: Microbial culture of the placenta yielded pure growth of Amycolatopsis spp. Histologic examination of the placenta revealed a focally expanding chorionitis with intralesional gram-positive filamentous bacilli and multifocal allantoic adenomatous hyperplasia on the apposing allantoic surface. Results: Treatment with lavage and oxytocin resulted in expulsion of the placental remnant within hours of parturition. The mare did not become pregnant again despite multiple breeding...
Migdał A, Migdał Ł, Oczkowicz M, Okólski A, Chełmońska-Soyta A.The aim of this study was to investigate the molecular mechanisms leading to the identification of pathogens by congenital immune receptors in foals up to 60 days of age. The study was conducted on 16 foal Polish Pony Horses (Polish Konik) divided into two study groups: control ( = 9) and experimental ( = 7). Foals from the experimental group received an intramuscular duplicate injection of 5 mL of Biotropina (Biowet) at 35 and 40 days of age. The RNA isolated from venous blood was used to evaluate the expression of the, , and genes using RT-PCR. The results of the experiment demonstrated a s...
Fehlberg LK, Lattimer JM, Drouillard JS, Douthit TL.Effects of Co on fiber digestibility in horses are largely unknown. Our objective was to evaluate effects of Co chloride on in vitro gas production, VFA production, and dry matter (DM) disappearance (IVDMD) using cecal fluid from 4 cannulated Quarter Horses. Five grams DM of alfalfa or smooth bromegrass hay were provided as substrate with Co added at 0.0, 0.5, 5.0, 25.0, or 50.0 mg/kg substrate DM. Ten milliliters cecal fluid and 140 mL McDougall's buffer were incubated in duplicate, and pH, VFA concentrations, and IVDMD were measured after 48 hours. Gas production, used as an indicator of...
Leeth C, Adkins J, Hay A, Bogers S, Potter A, Witonsky S, Zhu J.Immunological studies in the horse are frequently hampered by lack of environmental control, complicated study design, and ethical concerns when performing high risk studies. The purpose of the current study was to investigate the utility of a xenograft model for studying acute equine immune responses. Immunocompromised non obese diabetic (NOD). sudden combined immunodeficiency (scid).gamma-/- (NSG) mice were engrafted with either equine peripheral blood lymphocytes (PBLs) or equine bone marrow to determine an optimal protocol for equine lymphocyte engraftment. We found that both PBL and bone ...
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Schumacher J, Schumacher J, Blanchard T.The endometrial response of mares to repair of third-degree rectovestibular lacerations was evaluated. Endometrial biopsy specimens from 8 mares with third-degree rectovestibular laceration were obtained immediately before surgery and from 9 to 15 days after repair. Presurgical endometrial biopsy specimens were classified as category I for 2 mares; category II, attributable to slight endometritis, for 5 mares; and category III, attributable to moderate-to-severe endometritis, for 1 mare. Within 15 days after rectovestibular repair, all endometrial biopsy specimens were classified as category I...
Thakur BP, Sharma SK, Sharma A, Kumar A.Veterinarians working under remote field conditions are routinely presented with variety of surgical interventions in equines like castrations, management of wound, traumatic and congenital hernias and musculoskeletal disorders thus necessitating the use of general anaesthesia for management of these conditions. The present study was carried out to evaluate and recommend the suitable short term anaesthetic technique for Spiti ponies under field conditions. Seven clinically healthy male Spiti ponies presented for castration were evaluated for short term Total Intravenous Anaesthesia (TIVA) usin...
Andrew SE, Brooks DE, Biros DJ, Denis HM, Cutler TJ, Gelatt KN.OBJECTIVE: To describe and evaluate the use of posterior lamellar keratoplasty as a surgical treatment for deep corneal stromal abscesses in horses. Animals studied Nine horses of various breeds and ages that presented with corneal stromal abscesses located in the posterior one-third of the cornea. Procedure Retrospective medical record study. RESULTS: Nine horses had deep corneal stromal abscesses that were treated with posterior lamellar keratoplasty. Median patient age was 3 years. Six patients were females and three were geldings. Medical therapy alone had been attempted prior to surgery i...
Hedenström UO, Olsson U, Holm AW, Wattle OS.It has not yet been shown that ossification of ungular cartilages (OUC) is a pathological condition. Beside heredity, factors such as sex, age, repeated concussion, local trauma, hoof and body size have been suggested as contributing factors for OUC development. By comparing radiographs of front hooves from cold-blooded trotters with different age we wanted to evaluate when development of OUC in cold-blooded trotters occurs and if and when it stabilizes in relation to age and workload. Diagnosis and grading of OUC were based on radiological field examinations of 649 Swedish and Norwegian cold-...
Fuller CJ, Barr AR, Dieppe PA.An explant system was used to investigate the hypothesis that cartilage from different equine joints might respond differently to challenge with interleukin-1alpha (IL-1alpha). Pairs of normal cartilage samples were taken from the metacarpophalangeal, proximal interphalangeal and distal interphalangeal joints of six horses. One of each pair was stimulated with 10 ng/ml human recombinant IL-1alpha for three days, and the supernatants and remaining cartilage explants were analysed for their total content of glycosaminoglycans. A significantly higher percentage of glycosaminoglycans was released ...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Knight PK, Hamilton NA.To compare handedness of whip use by Australian jockeys in Melbourne (where racing is counterclockwise) and Sydney (where racing is clockwise). Methods: Photographs of finishes of Thoroughbred horse races in Melbourne and Sydney were examined. Where whip use was clearly visible, the venue, the hand in which the whip was held and the names of the jockey and the horse were determined. Comparisons of whip hand use between cities were made using the Chi-squared test. Results: A total of 771 identifications were made, 328 from Melbourne and 443 from Sydney, representing 78 jockeys and 506 horses. R...
Bailey RE, Dyson SJ, Parkin TD.The aims of this study were to establish the frequency of occurrence, intensity and symmetry of focal increased radiopharmaceutical uptake in the dorsoproximal aspect of the diaphysis of the proximal phalanx; to determine if this focal increased radiopharmaceutical uptake was related to age, height, gender, breed, bodyweight, or discipline of the horse, and if there was any relationship with lameness. Scintigraphic images from 690 horses were analyzed subjectively and objectively. Age, breed, discipline, height, weight, gender, and lame limb(s) or reasons for presentation were recorded for all...
Turner AS, Yovich JV, White NA, Embertson RE, Santschi EM, Slone DE.A retrospective study was performed to evaluate the healing of ventral midline abdominal incisions, closed with a simple continuous suture pattern using absorbable suture material, in 139 horses and foals. Dehiscence and incisional hernia developed separately in two horses. The low incidence of dehiscence and incisional hernia, compared with their reported incidence following the use of interrupted suture repair, leads the authors to recommend this alternative method of abdominal incision closure in horses. The security of closure is not sacrificed and the advantages of a rapid closure are des...
Mazet I, Pendland J, Boucias D.In this study, the phagocytic ability of Spodoptera exigua hemocytes was compared to horse neutrophils. In vitro assays showed that the insect granulocytes and horse neutrophils actively phagocytose FITC-labeled Paecilomyces farinosus blastospores opsonized with S. exigua hemolymph lectin or horse serum, respectively. Killing of fungal cells by the neutrophils and hemocytes was analyzed under in vitro conditions. Neutrophils reduced the growth of P. farinosus up to 65% whereas no fungicidal activity was observed with hemocyte monolayers. The production of oxygen metabolites by both phagocytic ...
Muurlink T, Walmsley J, Young D, Whitton C.Current noninvasive techniques for imaging the soft tissue structures of the stifle have limitations. Arthroscopy is commonly used for the investigation and treatment of stifle pain. Cranial and caudal arthroscopic approaches to the femorotibial joints are used. However, complete examination of the axial aspect of the medial femorotibial joint (MFTJ) is not possible currently. Objective: To develop a cranial approach to the caudal pouch of the MFTJ and to assess whether it would allow a more complete examination of the compartment and facilitate the caudomedial approach. Methods: The regional ...
Dean PW.Abnormalities of the nasal cavity, pharynx, larynx, and trachea result in respiratory noise and exercise intolerance. Clinical features of common upper respiratory conditions of performance horses are reviewed with emphasis on diagnosis, treatment, and risk factors that affect the outcome of surgical treatment.
Melo MI, Sereno JR, Henry M, Cassali GD.Pantaneiro horses are a breed native to flood plains of Brazil, where they thrive with little human interference. The aims of this study were to characterize age-associated changes in testicular size, serum testosterone and sexual behavior and to determine age at puberty as well as to evaluate daily sperm production in the Pantaneiro stallion. After weaning the males were kept in bachelor groups away from the females, in a separated area in the natural environment of flood plains. Infantile period ended at approximately 14.4 m.o. of age. Sexual interest and breeding capability first appeared b...
Enders F, Weber A.Fecal samples of 146 horses were culturally investigated for occurrence of Prototheca spp. using a selective medium, developed by PORE (1973). Prototheca zopfii could be isolated in monoculture from 9 fecal samples (6.2%). The results of this pilot study show that horses too can harbour and shed Prototheca spp. in variable frequency.
Loureiro KC, Lima-Verde IB, Johannisson A, Ntallaris T, Jager A, Štěpánek P, da Costa Mendonça M, Severino P, Morrell JM.Cryopreservation of stallion spermatozoa tends to cause plasma membrane damage due to the low ratio of cholesterol to phospholipids. Gums have been suggested as an alternative cryoprotectant to glycerol for stallion spermatozoa. Therefore, the present experiment was designed to verify whether the effect of addition of cashew gum (CG), or nanoparticles (NP) containing CG, to the extender before cooling on sperm quality in stallion semen. Ejaculates from 6 stallions were extended and split between six treatment groups (control, a-tocopherol [TOC], CG1, CG0.5, NP1 and NP0.5), stored in cryotubes ...
