Equine health encompasses the study and management of diseases, disorders, and overall well-being of horses. It involves understanding various physiological systems, preventive care, and treatment strategies to maintain optimal health in equine populations. Common areas of focus include nutrition, infectious diseases, orthopedic conditions, and reproductive health. Research in equine health aims to advance knowledge on diagnostic methods, therapeutic interventions, and management practices that improve horse welfare and performance. This page collects peer-reviewed research studies and scholarly articles that explore the diverse aspects of equine health, offering insights into current findings and advancements in the field.
Upjohn MM, Archer RM, Christley RM, McGowan CM.A telephone survey of 51 National Hunt racing yards with 1140 horses in training was made in April and May 2003 to establish the incidence of exertional rhabdomyolysis syndrome during the previous year. A case-control study was used to investigate the risk factors for the syndrome in eight yards selected on the basis that cases had been confirmed by the analysis of serum muscle enzymes. The overall incidence of syndrome was 6.1 cases per 100 horses per year, and 55 per cent of the yards reported at least one case. The risk factors identified were sex, the average length of the training gallop,...
Carnevale EM, Coutinho da Silva MA, Panzani D, Stokes JE, Squires EL.Oocyte transfer is a potential method to produce offspring from valuable mares that cannot carry a pregnancy or produce embryos. From 2000 through 2004, 86 mares, 19.2 +/- 0.4 yr of age (mean +/- S.E.M.), were used as oocyte donors in a clinical program at Colorado State University. Oocytes were collected from 77% (548/710) of preovulatory follicles and during 96% (548/570) of cycles. Oocytes were collected 21.0+/-0.1h after administration of hCG to estrous donors and cultured 16.4 +/- 0.2 h prior to transfer into recipients' oviducts. At 16 and 50 d after transfer, pregnancies were detected i...
Causey RC, Weber JA, Emmans EE, Stephenson LA, Homola AD, Knapp KR, Crowley IF, Pelletier DC, Wooley NA.The purpose of this study was to describe strain-specific immune responses to Streptococcus equi subspecies zooepidemicus (S. zooepidemicus) during uterine infection in horses. Five isolates of S. zooepidemicus were differentiated into four strains antigenically by bactericidal testing in blood of 12 horses, and genetically by pulsed-field gel electrophoresis. Eight healthy mares were then divided into two groups, each inoculated with one strain intrauterinely on three successive oestrous cycles followed by a second strain for three successive cycles, first and second strains being reversed fo...
Murray JK, Singer ER, Morgan KL, Proudman CJ, French NP.The cross-country phase of eventing competitions has been associated with injuries and fatalities to horses and riders. A case-control study was carried out to identify variables that were associated with increased or decreased risk of a horse fall on the cross-country phase at event competitions. After initial analysis, the dataset was split according to the categories of one-day events as compared to two- or three-day events to establish whether significant risk factors varied between the different types of eventing competitions. Data were collected for 121 cases (horse falls) at one-day eve...
Jacobsen S, Kjelgaard-Hansen M, Hagbard Petersen H, Jensen AL.The aim of the present study was to evaluate whether equine serum amyloid A (SAA) concentrations could be measured reliably with a turbidometric immunoassay (TIA) developed for use with human serum. Intra- and inter-assay imprecision were evaluated by multiple measurements on equine serum pools. Assay inaccuracy was determined by linearity under dilution. The assay was subsequently used for measuring SAA concentrations in clinically healthy horses, horses with inflammatory diseases, horses with non-inflammatory diseases, and in horses before and after castration. In pools with low, intermediat...
Janett F, Aebi L, Burger D, Imboden I, Hässig M, Kindahl H, Thun R.The objective of this study was to evaluate the effect of the non-steroidal anti-inflammatory drug (NSAID) vedaprofen (Quadrisol) on quality and freezability of stallion semen. Experiments were performed using 22 Franches Montagnes stallions from the National Stud in Avenches (Switzerland) randomly divided into a control and test group. Vedaprofen was given orally to all stallions of the test group at the recommended therapeutic dose (initial dose of 2mg/kg followed by 1mg/kg body weight every 12h) for 14 days. Control animals received the same amount of carrier substance. During treatment, bl...
Nagamine CM, Castro F, Buchanan B, Schumacher J, Craig LE.Spirochetes were identified histologically in canker (proliferative pododermatitis) in 3 horses. The data suggest that spirochetes may contribute to the pathology of equine chronic foot diseases similar to the manner in which they contribute to the pathology of bovine papillomatous digital dermatitis and contagious ovine digital dermatitis.
Tiwary AK, Puschner B, Kinde H, Tor ER.A 2-year-old bay Thoroughbred colt was found dead overnight in its stall without a known history of any illness, existing disease, or toxicant exposure. No information on the clinical signs before this animal's death was reported. A full necropsy was performed the next morning and revealed a mild to moderate degree of endocardial hemorrhages in both ventricles. Microscopic examination of the heart showed an acute mild multifocal necrosis of papillary muscles and ventricles. The stomach content contained approximately 2% Taxus alkaloids as determined by gas chromatography/mass spectrometry. In ...
Neild DM, Brouwers JF, Colenbrander B, Agüero A, Gadella BM.In this study we used a new method to detect reactive oxygen species (ROS) induced damage at the level of the sperm plasma membrane in fresh and frozen-thawed stallion sperm. Lipid peroxidation (LPO) in sperm cells was assessed by a fluorescent assay involving the labeling of stallion sperm with the LPO reporter probe C11-BODIPY(581/591). The peroxidation dependent spectral emission shift of this membrane probe could be localized using inverted spectral confocal microscopy and quantified on living and deteriorated sperm cells using flow cytometry. Mass spectrometric analysis of the main endoge...
Shaw FL, Handy RD, Bryson P, Sneyd JR, Moody AJ.The aim of the study was to investigate whether a single hyperbaric oxygen exposure causes oxidative stress in isolated platelets. Methods: Isolated horse platelets were exposed to 100% oxygen at 2.2 atmospheres, or 100% oxygen under normobaric conditions, or air under normobaric conditions for 90 min. Results: There were no differences in platelet SOD activity between conditions, but there was a rise in SOD in all cases after 24 h (in control platelets at 24 h, SOD was 11.9 +/- 1.9 nmol/min/mg protein compared to initial background levels of 8.2 +/- 1.9 nmol/min/mg protein) (P < 0.05). Nei...
Rambags BP, Krijtenburg PJ, Drie HF, Lazzari G, Galli C, Pearson PL, Colenbrander B, Stout TA.Chromosomal aberrations are often listed as a significant cause of early embryonic death in the mare, despite the absence of any concrete evidence for their involvement. The current study aimed to validate fluorescent in situ hybridization (FISH) probes to label specific equine chromosomes (ECA2 and ECA4) in interphase nuclei and thereby determine whether numerical chromosome abnormalities occur in horse embryos produced either in vivo (n = 22) or in vitro (IVP: n = 20). Overall, 75% of 36,720 and 88% of 2,978 nuclei in the in vivo developed and IVP embryos were analyzable. Using a scoring sys...
Whiting TL, Salmon RH, Wruck GC.Nine of 45 horses subjected to prolonged malnutrition died subsequent to being placed with a responsible caregiver and being provided an appropriate diet. Initial extreme poor body condition score tended to be associated with death, although individual response to refeeding varied. The financial costs of stabilizing the group of horses significantly exceeded their free market price. Responsible management of chronically starved commercial animals should include options for immediate euthanasia. Neuf des 45 chevaux soumis à une malnutrition prolongée sont morts après avoir été placés che...
Szeredi L, Hotzel H, Sachse K.Seventy-seven cases of equine abortion from 49 Hungarian farms that occurred between 1998 and 2000 were investigated for the presence of chlamydiae by immunohistochemistry, PCR and/or MZN staining. Evidence of the presence of these bacteria was obtained in 64 cases (83.1%) from 41 (83.7%) different farms. Partial ompA gene sequencing of PCR products revealed that the agent was Chlamydophila psittaci. Based on the findings of microbial diagnosis, pathology and case history, chlamydial infection was considered to be the most likely cause of abortion in at least 11 (14.3%) cases. In the remaining...
Li F, Stevenson RA, Crabb BS, Studdert MJ, Hartley CA.Equine rhinitis A virus (ERAV) is a significant pathogen of horses and is also closely related to Foot-and-mouth disease virus (FMDV). Despite these facts, knowledge of the prevalence and importance of ERAV infections remains limited, largely due to the absence of a simple, robust diagnostic assay. In this study, we compared the antigenicities of recombinant full-length and fragmented ERAV capsid proteins expressed in Escherichia coli by using sera from experimentally infected and naturally exposed horses. We found that, from the range of antigens tested, recombinant proteins encompassing the ...
Harrington JR, Golding MC, Martens RJ, Halbert ND, Cohen ND.To evaluate a real-time quantitative polymerase chain reaction (QPCR) assay in the detection and quantitation of virulent Rhodococcus equi. Methods: 1 virulent, 2 intermediately virulent, and 2 avirulent strains of R. equi and 16 isolates of bacteria genetically related to R. equi. Methods: The QPCR assay was evaluated for detection and quantitation of the virulence-associated gene (vapA) of R. equi in pure culture and in samples of tracheobronchial fluid, which were inoculated with known numbers of virulent R. equi. Results were compared with those derived via quantitative microbial culture a...
Beretta C, Garavaglia G, Cavalli M.We report on the inhibitory activity of the NSAIDs meloxicam, carprofen, phenylbutazone and flunixin, on blood cyclooxygenases in the horse using in vitro enzyme-linked assays. As expected, comparison of IC50 indicated that meloxicam and carprofen are more selective inhibitors of COX-2 than phenylbutazone and flunixin; meloxicam was the most advantageous for horses of four NSAIDs examined. However at IC80, phenylbutazone (+134.4%) and flunixin (+29.7%) had greater COX-2 selectivity than at IC50, and meloxicam (-41.2%) and carprofen (-12.9%) had lower COX-2 selectivity than at IC50. We therefor...
Estepa JC, Lopez I, Mayer-Valor R, Rodriguez M, Aguilera-Tejero E.The aim of this study was to evaluate the influence of two commonly used anticoagulants (K3EDTA and lithium heparin) on refractometric and spectrophotometric measurement of total protein (TP) concentration in equine peritoneal fluid samples. The influence of a commercial solution of K3EDTA, a solution of K3EDTA in distilled water and lithium heparin on the refractometric and spectrophotometric (biuret) quantification of TP content in peritoneal fluid samples was assessed. Total protein concentration measured by refractometry was consistently overestimated in samples with commercial K3EDTA. The...
Ward MP, Couëtil LL.To estimate the association between climate and airborne pollen and fungal factors and chronic obstructive pulmonary disease (COPD) in horses. Methods: Data from 1,444 horses with a diagnosis of COPD. Methods: The Veterinary Medical Database was used to identify records of horses admitted to veterinary teaching hospitals in the United States and Canada between 1990 and 1999. Rainfall, mean minimum and maximum temperature, and maximum monthly pollen and fungal spore (mold) counts recorded at the city closest to where the hospital is located were identified for each month data were reported to t...
Rossano MG, Schott HC, Kaneene JB, Murphy AJ, Kruttlin EA, Hines MT, Sellon DC, Patterson JS, Elsheikha HM, Dubey JP, Mansfield LS.To determine whether daily administration of pyrantel tartrate can prevent infection in horses experimentally challenged with Sarcocystis neurona. Methods: 24 mixed-breed specific-pathogen-free weanling horses, 10 adult horses, 1 opossum, and 6 mice. Methods: Sarcocystis neurona-naïve weanling horses were randomly allocated to 2 groups. Group A received pyrantel tartrate at the labeled dose, and group B received a nonmedicated pellet. Both groups were orally inoculated with 100 sporocysts/d for 28 days, 500 sporocysts/d for 28 days, and 1000 sporocysts/d for 56 days. Blood samples were collec...
Caminoto EH, Alves AL, Amorim RL, Thomassian A, Hussni CA, Nicoletti JL.To evaluate the effects of extracorporeal shock wave therapy (ESWT) on affected ligaments in the hind limbs of horses with experimentally induced suspensory ligament desmitis by use of ultrasonographic, ultrastructural, and immunocytochemical techniques. Methods: 10 horses. Methods: Suspensory ligament desmitis was induced in both hind limbs of each horse by use of 2 collagenase injections (administered 2 weeks apart) in each suspensory ligament. Two weeks after the second injection, the right hind limb of each horse was treated with ESWT (3 treatments at 3-week intervals); the left hind limb ...
Mencke N, Larsen KS, Eydal M, Sigurethsson H.Lice infestations in horses caused by the chewing louse Werneckiella (Damalinia) equi are observed worldwide. In the present study, the efficacy of 10% imidacloprid was tested on horses naturally infested with lice. Two groups of animals received a double application of 4 ml and 8 ml Advantage 10% spot-on on day 0 and 28 either. Horses, presenting dermatological signs with negative lice counts, were also included in this investigation. 40.86% of the horses presented positive lice counts and 84.21% of these animals showed clinical dermatologic signs. 65.45% of the lice-negative horses also show...
Camacho AT, Guitian FJ, Pallas E, Gestal JJ, Olmeda AS, Habela MA, Telford SR, Spielman A.The control of equine piroplasmosis is becoming increasingly important to maintain the international market open to the horse industry. The purpose of this study was to demonstrate the occurrence of equine piroplasmosis (Theileria equi and Babesia caballi) in Galicia, north-west Spain, and to compare haematological and serum biochemistry parameters between non-parasitaemic horses and horses parasitaemic with T. equi and B. caballi. Sixty serum samples (control group) were taken from healthy horses pastured on two farms, and examined for evidence of equine T. equi and B. caballi infection by in...
Teglas M, Matern E, Lein S, Foley P, Mahan SM, Foley J.Blood samples and ticks were collected from 48 cattle and 74 horses from seven sites in the Peten region of Guatemala. Data on body condition, mucous membrane capillary refill time and tick infestation levels were recorded for each animal in the study. Horses had significantly higher levels of tick infestation than cattle, as well as poorer body condition scores. Seroprevalence of Babesia spp. was 95.8% for B. bovis in cattle, 89.6% for B. bigemina in cattle, and 92.7% for B. equi in horses. Seroprevalence of Anaplasma marginale in cattle was 87.5%, similar to reports in animals from other reg...
Baumber J, Ball BA, Linfor JJ.To evaluate the effect of the addition of enzyme scavengers and antioxidants to the cryopreservation extender on characteristics of equine spermatozoa after freezing and thawing. Methods: 2 ejaculates collected from each of 5 stallions. Methods: Equine spermatozoa were cryopreserved in freezing extender alone (control samples) or with the addition of catalase (200 U/mL), superoxide dismutase (200 U/mL), reduced glutathione (10 mM), ascorbic acid (10 mM), alpha-tocopherol (25, 50, 100, or 500 microM or 1 mM), or the vehicle for alpha-tocopherol (0.5% ethanol). After thawing, spermatozoal motili...
Lorenzo-Figueras M, Preston T, Ott EA, Merritt AM.To evaluate the effect of ingestion of a high-carbohydrate versus a high-fat meal on relaxation of the proximal portion of the stomach and subsequent gastric emptying in horses. Methods: 6 healthy adult horses. Methods: The study consisted of 2 phases. In phase I, horses were offered a high-fat (8% fat) or a high-carbohydrate (3% fat) pelleted meal (0.5 g/kg) of identical volume, caloric density, and protein content. In phase II, meals consisted of a commercial sweet feed meal (0.5 g/kg) or this meal supplemented with corn oil (12.3% fat) or an isocaloric amount of glucose (2.9% fat). Proximal...
Auer JA, Martens RJ.Valgus deformities were created in 6 pony foals by hemicircumferential transection of the periosteum and periosteal stripping (HCTP and PS) just proximally to the distal physis on the medial side of 1 radius (principal thoracic limb). The opposite thoracic limb served as a control. One month after this surgical procedure was done, the limbs were radiographed and the angle of deviation was determined. All horses developed a valgus deformity of the principal limb. In an effort to correct the acquired valgus deformity, the 2nd surgical procedure was performed--HCTP and PS on the lateral aspect of...
Trim CM, Eaton SA, Parks AH.An 8-year-old Thoroughbred gelding with colic was anesthetized for surgical correction of right dorsal displacement of the ascending colon. Removal of the nasogastric tube at the end of surgery resulted in hemorrhage from the nares and loss of 24 L of blood. Treatment included administration of acetated Ringer's solution, hypertonic saline solution, and dobutamine. A blood transfusion was started after hemorrhage was controlled, and arterial pressure was restored to the prehemorrhage value, but was stopped after infusion of 2.7 L of blood because of a suspected adverse reaction. This case indi...
Dyson SJ.Desmitis of the accessory ligament of the deep digital flexor tendon (ALDDFT) was diagnosed in 27 horses between September 1986 and December 1990. The first observed clinical sign in four horses was localised swelling in the proximal metacarpus. Twenty horses became lame suddenly during a work period and most developed swelling within 24 h of exercise. The injury was confirmed by ultrasonographic examination. Ten of 13 horses with uncomplicated desmitis of the ALDDFT resumed full work, within three to nine months of the onset of clinical signs, without recurrence of clinical signs in the perio...
Lamas LP, Edmonds J, Hodge W, Zamora-Vera L, Burford J, Coomer R, Munroe G.REASONS FOR PERFORMING THIS STUDY: Intra-articular ethanol has been described to promote distal tarsal joint ankylosis. Its use and results in clinical cases affected by osteoarthritis (OA) have not been reported. Objective: To describe and evaluate the results of treatment of distal tarsal joint OA by facilitated ankylosis stimulated by intra-articular ethanol injection. Methods: Twenty-four horses met the inclusion criteria of tarsometatarsal and centrodistal joint OA diagnosed by a positive response to intra-articular analgesia, radiographic evaluation and recurrence of lameness ≤ 4 month...
de Linde Henriksen M, Andersen PH, Mietelka K, Farina L, Thomsen PD, Plummer CE, Mangan BG, Heegaard S, Coleman JK, Toft N, Brooks DE.To investigate histopathologic and immunohistochemical aspects of equine deep stromal abscesses (DSA) with a focus on the histopathologic diagnosis, presumptive etiology, and the immunohistochemical expression of three angiogenesis-related factors: vascular endothelial growth factor-A (VEGF-A), pigment epithelium-derived factor (PEDF), and interleukin-1 receptor antagonist (IL-1ra). Methods: Paraffin-embedded biopsy samples from 51 DSA. The biopsies were collected from full-thickness penetrating keratoplasty or split-thickness lamellar keratoplasty surgeries at the University of Florida Veteri...
Christensen BW, Roberts JF, Pozor MA, Giguere S, Sells SF, Donahue JM.A 4-year-old Thoroughbred mare was evaluated because of placental abnormalities and a retained placental remnant. Results: Microbial culture of the placenta yielded pure growth of Amycolatopsis spp. Histologic examination of the placenta revealed a focally expanding chorionitis with intralesional gram-positive filamentous bacilli and multifocal allantoic adenomatous hyperplasia on the apposing allantoic surface. Results: Treatment with lavage and oxytocin resulted in expulsion of the placental remnant within hours of parturition. The mare did not become pregnant again despite multiple breeding...
Migdał A, Migdał Ł, Oczkowicz M, Okólski A, Chełmońska-Soyta A.The aim of this study was to investigate the molecular mechanisms leading to the identification of pathogens by congenital immune receptors in foals up to 60 days of age. The study was conducted on 16 foal Polish Pony Horses (Polish Konik) divided into two study groups: control ( = 9) and experimental ( = 7). Foals from the experimental group received an intramuscular duplicate injection of 5 mL of Biotropina (Biowet) at 35 and 40 days of age. The RNA isolated from venous blood was used to evaluate the expression of the, , and genes using RT-PCR. The results of the experiment demonstrated a s...
Fehlberg LK, Lattimer JM, Drouillard JS, Douthit TL.Effects of Co on fiber digestibility in horses are largely unknown. Our objective was to evaluate effects of Co chloride on in vitro gas production, VFA production, and dry matter (DM) disappearance (IVDMD) using cecal fluid from 4 cannulated Quarter Horses. Five grams DM of alfalfa or smooth bromegrass hay were provided as substrate with Co added at 0.0, 0.5, 5.0, 25.0, or 50.0 mg/kg substrate DM. Ten milliliters cecal fluid and 140 mL McDougall's buffer were incubated in duplicate, and pH, VFA concentrations, and IVDMD were measured after 48 hours. Gas production, used as an indicator of...
Leeth C, Adkins J, Hay A, Bogers S, Potter A, Witonsky S, Zhu J.Immunological studies in the horse are frequently hampered by lack of environmental control, complicated study design, and ethical concerns when performing high risk studies. The purpose of the current study was to investigate the utility of a xenograft model for studying acute equine immune responses. Immunocompromised non obese diabetic (NOD). sudden combined immunodeficiency (scid).gamma-/- (NSG) mice were engrafted with either equine peripheral blood lymphocytes (PBLs) or equine bone marrow to determine an optimal protocol for equine lymphocyte engraftment. We found that both PBL and bone ...
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Schumacher J, Schumacher J, Blanchard T.The endometrial response of mares to repair of third-degree rectovestibular lacerations was evaluated. Endometrial biopsy specimens from 8 mares with third-degree rectovestibular laceration were obtained immediately before surgery and from 9 to 15 days after repair. Presurgical endometrial biopsy specimens were classified as category I for 2 mares; category II, attributable to slight endometritis, for 5 mares; and category III, attributable to moderate-to-severe endometritis, for 1 mare. Within 15 days after rectovestibular repair, all endometrial biopsy specimens were classified as category I...
Thakur BP, Sharma SK, Sharma A, Kumar A.Veterinarians working under remote field conditions are routinely presented with variety of surgical interventions in equines like castrations, management of wound, traumatic and congenital hernias and musculoskeletal disorders thus necessitating the use of general anaesthesia for management of these conditions. The present study was carried out to evaluate and recommend the suitable short term anaesthetic technique for Spiti ponies under field conditions. Seven clinically healthy male Spiti ponies presented for castration were evaluated for short term Total Intravenous Anaesthesia (TIVA) usin...
Andrew SE, Brooks DE, Biros DJ, Denis HM, Cutler TJ, Gelatt KN.OBJECTIVE: To describe and evaluate the use of posterior lamellar keratoplasty as a surgical treatment for deep corneal stromal abscesses in horses. Animals studied Nine horses of various breeds and ages that presented with corneal stromal abscesses located in the posterior one-third of the cornea. Procedure Retrospective medical record study. RESULTS: Nine horses had deep corneal stromal abscesses that were treated with posterior lamellar keratoplasty. Median patient age was 3 years. Six patients were females and three were geldings. Medical therapy alone had been attempted prior to surgery i...
Hedenström UO, Olsson U, Holm AW, Wattle OS.It has not yet been shown that ossification of ungular cartilages (OUC) is a pathological condition. Beside heredity, factors such as sex, age, repeated concussion, local trauma, hoof and body size have been suggested as contributing factors for OUC development. By comparing radiographs of front hooves from cold-blooded trotters with different age we wanted to evaluate when development of OUC in cold-blooded trotters occurs and if and when it stabilizes in relation to age and workload. Diagnosis and grading of OUC were based on radiological field examinations of 649 Swedish and Norwegian cold-...
Fuller CJ, Barr AR, Dieppe PA.An explant system was used to investigate the hypothesis that cartilage from different equine joints might respond differently to challenge with interleukin-1alpha (IL-1alpha). Pairs of normal cartilage samples were taken from the metacarpophalangeal, proximal interphalangeal and distal interphalangeal joints of six horses. One of each pair was stimulated with 10 ng/ml human recombinant IL-1alpha for three days, and the supernatants and remaining cartilage explants were analysed for their total content of glycosaminoglycans. A significantly higher percentage of glycosaminoglycans was released ...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Knight PK, Hamilton NA.To compare handedness of whip use by Australian jockeys in Melbourne (where racing is counterclockwise) and Sydney (where racing is clockwise). Methods: Photographs of finishes of Thoroughbred horse races in Melbourne and Sydney were examined. Where whip use was clearly visible, the venue, the hand in which the whip was held and the names of the jockey and the horse were determined. Comparisons of whip hand use between cities were made using the Chi-squared test. Results: A total of 771 identifications were made, 328 from Melbourne and 443 from Sydney, representing 78 jockeys and 506 horses. R...
Bailey RE, Dyson SJ, Parkin TD.The aims of this study were to establish the frequency of occurrence, intensity and symmetry of focal increased radiopharmaceutical uptake in the dorsoproximal aspect of the diaphysis of the proximal phalanx; to determine if this focal increased radiopharmaceutical uptake was related to age, height, gender, breed, bodyweight, or discipline of the horse, and if there was any relationship with lameness. Scintigraphic images from 690 horses were analyzed subjectively and objectively. Age, breed, discipline, height, weight, gender, and lame limb(s) or reasons for presentation were recorded for all...
Turner AS, Yovich JV, White NA, Embertson RE, Santschi EM, Slone DE.A retrospective study was performed to evaluate the healing of ventral midline abdominal incisions, closed with a simple continuous suture pattern using absorbable suture material, in 139 horses and foals. Dehiscence and incisional hernia developed separately in two horses. The low incidence of dehiscence and incisional hernia, compared with their reported incidence following the use of interrupted suture repair, leads the authors to recommend this alternative method of abdominal incision closure in horses. The security of closure is not sacrificed and the advantages of a rapid closure are des...
Mazet I, Pendland J, Boucias D.In this study, the phagocytic ability of Spodoptera exigua hemocytes was compared to horse neutrophils. In vitro assays showed that the insect granulocytes and horse neutrophils actively phagocytose FITC-labeled Paecilomyces farinosus blastospores opsonized with S. exigua hemolymph lectin or horse serum, respectively. Killing of fungal cells by the neutrophils and hemocytes was analyzed under in vitro conditions. Neutrophils reduced the growth of P. farinosus up to 65% whereas no fungicidal activity was observed with hemocyte monolayers. The production of oxygen metabolites by both phagocytic ...
Muurlink T, Walmsley J, Young D, Whitton C.Current noninvasive techniques for imaging the soft tissue structures of the stifle have limitations. Arthroscopy is commonly used for the investigation and treatment of stifle pain. Cranial and caudal arthroscopic approaches to the femorotibial joints are used. However, complete examination of the axial aspect of the medial femorotibial joint (MFTJ) is not possible currently. Objective: To develop a cranial approach to the caudal pouch of the MFTJ and to assess whether it would allow a more complete examination of the compartment and facilitate the caudomedial approach. Methods: The regional ...
Dean PW.Abnormalities of the nasal cavity, pharynx, larynx, and trachea result in respiratory noise and exercise intolerance. Clinical features of common upper respiratory conditions of performance horses are reviewed with emphasis on diagnosis, treatment, and risk factors that affect the outcome of surgical treatment.
Melo MI, Sereno JR, Henry M, Cassali GD.Pantaneiro horses are a breed native to flood plains of Brazil, where they thrive with little human interference. The aims of this study were to characterize age-associated changes in testicular size, serum testosterone and sexual behavior and to determine age at puberty as well as to evaluate daily sperm production in the Pantaneiro stallion. After weaning the males were kept in bachelor groups away from the females, in a separated area in the natural environment of flood plains. Infantile period ended at approximately 14.4 m.o. of age. Sexual interest and breeding capability first appeared b...
Enders F, Weber A.Fecal samples of 146 horses were culturally investigated for occurrence of Prototheca spp. using a selective medium, developed by PORE (1973). Prototheca zopfii could be isolated in monoculture from 9 fecal samples (6.2%). The results of this pilot study show that horses too can harbour and shed Prototheca spp. in variable frequency.