Equine health encompasses the study and management of diseases, disorders, and overall well-being of horses. It involves understanding various physiological systems, preventive care, and treatment strategies to maintain optimal health in equine populations. Common areas of focus include nutrition, infectious diseases, orthopedic conditions, and reproductive health. Research in equine health aims to advance knowledge on diagnostic methods, therapeutic interventions, and management practices that improve horse welfare and performance. This page collects peer-reviewed research studies and scholarly articles that explore the diverse aspects of equine health, offering insights into current findings and advancements in the field.
Gehlen H, Loschelder J, Walther M.Euthanasia represents a procedure with high responsibility for veterinarians in equine practice. The procedure should avoid pain and suffering for the horse and be carried out with the least possible stress for the patient and its owner. The presented study investigated the emotional impact of a horse's euthanasia procedure on the owner in order to enable development of future recommendations in improving the management of this procedure in horses. Methods: Questionnaires concerning euthanasia of a horse for horse owners and veterinarians, respectively were developed and sent by mail or publis...
Sievert M, Krohn J, Wehrend A.Due to the special structure of the equine placenta, foals depend on an adequate intake of high-quality colostrum post natum in order to ensure the development of passive immunity. The quality of the colostrum is determined, among other things, by the IgG content. This may be evaluated in the colostrum by direct and indirect methods (density and refractive index). The density of the colostrum is measured by a colostrometer and should amount to at least 1060 g/l. Refractometry is suitable for assessing the relative density or refractive index. Good equine colostrum has a Brix value of at leas...
The Journal of heredityOctober 20, 2019
Volume 110, Issue 7 769-781 doi: 10.1093/jhered/esz032
Han H, Bryan K, Shiraigol W, Bai D, Zhao Y, Bao W, Yang S, Zhang W, MacHugh DE, Dugarjaviin M, Hill EW.The Mongolian horse is one of the oldest extant horse populations and although domesticated, most animals are free-ranging and experience minimal human intervention. As an ancient population originating in one of the key domestication centers, the Mongolian horse may play a key role in understanding the origins and recent evolutionary history of horses. Here we describe an analysis of high-density genome-wide single-nucleotide polymorphism (SNP) data in 40 globally dispersed horse populations (n = 895). In particular, we have focused on new results from Chinese Mongolian horses (n = 100) that ...
Álvarez C, González N, Luño V, Martínez F, Gil L.The aim of this study was to test and compare two new components in extenders for freezing donkey semen: mare colostrum and jenny colostrum. Colostrum was obtained from four mares and four jennies right after the foal's birth. Ejaculates were collected from five fertile donkeys. Sperm samples were pooled, diluted and cryopreserved in three different experimental extender groups: lactose supplemented with egg yolk extender (20%) as the control group, lactose supplemented with jenny colostrum extender (20%), and lactose supplemented with mare colostrum extender (20%). After thawing, we evaluated...
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Consuegra C, Crespo F, Dorado J, Diaz-Jimenez M, Pereira B, Hidalgo M.Lipids and proteins can be used for sperm vitrification to preserve the integrity of sperm membranes or to increase the viscosity of the medium. This study evaluated the effect of low-density lipoproteins (LDL) and milk serum proteins (Pronexcell) for stallion sperm vitrification. Hippex extender (Barex Biochemical Products, The Netherlands), plus 1% of bovine serum albumin and 100 mM of trehalose, was used as control for sperm vitrification. In experiment 1, different concentrations of LDL (L1 = 0.25, L2 = 0.5, L3 = 1%) and in experiment 2 of Pronexcell (P1 = 1, P2 = 5, P3 = 10%)...
Li X, Ni HB, Ren WX, Jiang J, Gong QL, Zhang XX.Toxoplasmosis, one of the most common zoonoses worldwide, is caused by Toxoplasma gondii. T. gondii can infect almost all warm-blooded animals, including humans. Horses are an intermediate host of T. gondii, representing a potential risk for humans. To determine the T. gondii seroprevalence in horses worldwide, a global meta-analysis was conducted. A total of 35 publications were obtained by searching the PubMed, ScienceDirect, Chinese Web of knowledge (CNKI) and Wanfang databases. A total of 12,354 horses were assessed, of which 1580 were positive for T. gondii. The pooled overall seroprevale...
Pereira B, Dorado J, Diaz-Jimenez M, Consuegra C, Ortiz I, Gosalvez J, Hidalgo M.The acquisition of equine oocyte developmental capacity is ensured by the follicular environment, such as granulosa cells, which could reflect the meiotic development potential of immature oocytes. This study evaluated the relationship between DNA fragmentation of granulosa cells, using the chromatin dispersion test, and equine oocyte meiotic development after in vitro maturation. Granulosa cells and cumulus-oocytes complexes (n = 50) were recovered from slaughterhouse-derived ovaries. Oocytes were in vitro matured, stained and evaluated under fluorescence microscopy. Maturation rates were c...
Meister TL, Tegtmeyer B, Brüggemann Y, Sieme H, Feige K, Todt D, Stang A, Cavalleri JV, Steinmann E.An equine parvovirus-hepatitis (EqPV-H) has been recently identified in association with equine serum hepatitis, also known as Theiler's disease. The disease was first described by Arnold Theiler in 1918 and is often observed with parenteral use of blood products in equines. However, natural ways of viral circulation and potential risk factors for transmission still remain unknown. In this study, we investigated the occurrence of EqPV-H infections in Thoroughbred horses in northern and western Germany and aimed to identify potential risk factors associated with viral infections. A total of 392...
Gonzales-Viera O, Fritz H, Mete A.A 7-month-old female mixed breed foal with a 2-day history of recumbency and inability to open its mouth convulsed acutely and died and was submitted for necropsy examination. The foal was thin and large patches of haemorrhage were present throughout the peritoneal wall, the diaphragmatic surfaces and the retroperitoneum. Numerous nematode larvae were visible on the serosal surfaces and penetrated and embedded into the subserosa associated with the haemorrhages. The dorsal portion of the abdominal diaphragm had a partial tear and large numbers of nematodes were within the muscle fibres. Histol...
Girardi FM, da Fonseca LA, Ribeiro Filho JD, Souto PC, Ferreira DAC, Dornelas LRSM, Bento LD, de Carvalho Filho WP.Obesity in human and veterinary medicine is one of the most complex challenges within emerging diseases in the context of health. The problem of obesity in horses results in severe comorbidities; therefore, acute-phase proteins should be investigated for fluctuations increasing or decreasing by at least 25% in response to inflammation; these are candidates for future biomarkers and might provide new perspectives on early diagnosis and prognosis. Serum samples were analyzed in nine healthy animals (C) and nine obese animals (O). The proteins were separated by sodium dodecyl sulfate-polyacrylami...
Marycz K, Szłapka-Kosarzewska J, Geburek F, Kornicka-Garbowska K.Equine metabolic syndrome (EMS) is characterized by adiposity, insulin dysregulation and increased risk for laminitis. Increased levels of specific liver enzymes in the peripheral blood are typical findings in horses diagnosed with EMS. Current management of EMS is based on caloric restriction and increased physical activity. However, new potential treatment options are arising such as the transplantation of autologous adipose stem cells (ASC). However, cytophysiological properties of ASC derived from EMS horses are impaired which strongly limits their therapeutic potential. We hypothesized, t...
Back H, Weld J, Walsh C, Cullinane A.The aim of this study was to identify respiratory viruses circulating amongst elite racehorses in a training yard by serological testing of serial samples and to determine their impact on health status and ability to race. A six-month longitudinal study was conducted in 30 Thoroughbred racehorses (21 two-year-olds, five three-year-olds and four four-year-olds) during the Flat racing season. Sera were tested for the presence of antibodies against equine herpesvirus 1 and 4 (EHV-1 and EHV-4) and equine rhinitis viruses A and B (ERAV and ERBV) by complement fixation (CF) and equine arteritis viru...
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Ginés-Díaz A, Martínez-Romero MT, Cejudo A, Aparicio-Sarmiento A, Sainz de Baranda P.Previous research has analyzed how the sport influences sagittal spinal curvatures in young athletes and has found that spinal curves may be modified as a consequence of repeated movement patterns and postures of each discipline. Objective: To analyze sagittal spinal alignment by equestrian discipline and its relation to training load, and to describe "sagittal integrative morphotype" in young riders. Methods: Observational descriptive study. Methods: Training room. Methods: A total of 23 riders (aged 9-17 y)-13 dressage riders (3 males and 10 females) and 10 show jumping riders (5 males and ...
Padalino B, Rosanowski SM, Di Bella C, Lacinio R, Rubino GTR.This study aimed to document the prevalence of chronic equine piroplasmosis (EP) in poorly performing Standardbred racehorses and to explore associations between the disease and sex, age, and hematological parameters. Blood was collected between 2004 and 2018; blood cell counts were performed using a cell counter analyzer, biochemical parameters using a photometer, and serum proteins using agarose gel electrophoresis. Blood smears were prepared, colored with a modified Giemsa, and an experienced technician identified the presence of protozoa. The horses were categorized into piroplasmosis posi...
Neuhauser S, Bollwein H, Siuda M, Handler J.The aim of the present study was to evaluate the effect of different freezing procedures on sperm motion, viability, the acrosome status, mitochondrial membrane potential (MMP), intracellular calcium content, and DNA integrity on epididymal stallion sperm. Therefore, the sperm of 10 healthy stallions was harvested by retrograde flushing after testectomy, diluted with a semen extender containing defined milk proteins and a freezing extender containing egg yolk and glycerol and frozen according to 4 different protocols, using a programmable freezer and a floating rack performing a slow (processe...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Fitzgerald DM, Pollitt CC, Walsh DM, Sillence MN, de Laat MA.The oral glucose test (OGT) is a useful tool for diagnosing insulin dysregulation (ID) and is somewhat repeatable in ponies under consistent management. This study aimed to determine whether the insulin and incretin responses to an OGT in ponies differed after short-term access to fertilised pasture, compared to unfertilised pasture, by using a randomised, repeated measures study design. Sixteen mixed-breed ponies were classified as severely insulin-dysregulated (SD; post-prandial insulin ≥80 μIU/mL) or not severely insulin-dysregulated (NSD; post-prandial insulin < 80 μIU/mL) using an O...
Leschke DH, Muir GS, Hodgson JK, Coyle M, Horn R, Bertin FR.Diseases associated with insulin dysregulation (ID), such as equine metabolic syndrome and pituitary pars intermedia dysfunction, are of interest to practitioners because of their association with laminitis. Accurate insulin concentration assessment is critical in diagnosing and managing these diseases. Objective: To determine the effect of time, temperature, and collection tube type on insulin concentrations in horses at risk of ID. Methods: Eight adult horses with body condition score >6/9. Methods: In this prospective study, subjects underwent an infeed oral glucose test 2 hours before...
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Isgren CM, Salem SE, Singer ER, Wylie CE, Lipreri G, Graham RJTY, Bladon B, Boswell JC, Fiske-Jackson AR, Mair TS, Rubio-Martínez LM.Previous studies investigating factors associated with survival following endoscopic treatment of contamination/sepsis of the calcaneal bursa are limited. Objective: To investigate the factors associated with survival in horses with contamination/sepsis of the calcaneal bursae treated endoscopically and to describe the bacterial isolates involved in the synovial infections. Methods: Retrospective analysis of clinical records. Methods: Medical records from 128 horses with contamination/sepsis of the calcaneal bursae treated by endoscopic lavage at seven equine hospitals were reviewed. A follow-...
Kydd JH, Hannant D, Robinson RS, Bryant N, Osterrieder N.Equid herpesvirus-1 (EHV-1) causes respiratory and neurological disease and late gestation abortion in pregnant mares. Current vaccines contain either inactivated or live EHV-1, but fail to provide complete clinical or virological protection, namely prevention of nasopharyngeal shedding and cell-associated viraemia. Thus, the development of novel products, such as modified live virus (MLV) vaccines which stimulate virus-specific, humoral and cell mediated immune responses more effectively remains a priority. Two groups of weaned foals (n = 6 each group) were used in a longitudinal, prospec...
Chen JW, Stefanovski D, Haughan J, Jiang Z, Boston R, Soma LR, Robinson MA.Extracorporeal shockwave therapy (ESWT) can potentially mask painful injuries in equine athletes. Tests to detect whether a horse has received ESWT prior to competition are needed. Extracorporeal shockwave therapy is known to affect inflammatory mediators in other species, and if these mediators are altered in the horse, these could serve as biomarkers of ESWT. Objective: To test the hypothesis that a single application of ESWT will alter the circulating protein concentrations of 10 inflammatory mediators in horse plasma. Methods: Prospective repeated measures experimental study. Methods: Elev...
Yao C.The kinetoplastid protozoan Leishmania spp. cause leishmaniasis, which clinically exhibit mainly as a cutaneous, mucocutanous or visceral form depending upon the parasite species in humans. The disease is widespread geographically, leading to 20 000 annual deaths. Here, leishmaniases in both humans and animals, reservoirs and sand fly vectors on the Caribbean islands are reviewed. Autochthonous human infections by Leishmania spp. were found in the Dominican Republic, Guadeloupe and Martinique as well as Trinidad and Tobago; canine infections were found in St. Kitts and Grenada; and equine infe...
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
Thompson RE, Johnson AK, Prado TM, Premanandan C, Brown ME, Whitlock BK, Pukazhenthi BS.Availability of viable frozen-thawed endometrial tissues could facilitate detailed studies into physiologic and disease processes influencing the endometrium. This study was designed to investigate the cryosurvival of equine endometrial tissue. Previous studies in the human and horse have focused on cryopreservation of dissociated endometrial cells. To our knowledge, there are no studies on cryopreservation of endometrial explants. Our objectives were to 1) determine the influence of differing concentrations of the permeating cryoprotectant dimethyl sulfoxide (MeSO) on viability, structural in...
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Verheyen T, Decloedt A, De Clercq D, van Loon G.Atypical myopathy (AM) is an acute, fatal rhabdomyolysis in grazing horses that mainly affects skeletal muscles. Postmortem examinations have shown that myocardial damage also occurs. Limited information is available on the effect of AM on cardiac function in affected and surviving horses. Objective: To describe electrocardiographic and echocardiographic changes associated with AM in the acute stage of the disease and after follow-up. Methods: Horses (n = 12) diagnosed with AM in which cardiac ultrasound examination and ECG recording were available. Methods: All horses underwent clinical exami...
Silver M, Fowden AL, Knox J, Ousey JC, Franco R, Rossdale PD.The effects of insulin-induced hypoglycaemia on plasma catecholamines, cortisol and metabolites have been examined in newborn and 7-14-day-old foals. The fall in plasma glucose elicited by the highest dose of insulin (1.0 i.u./kg) given to the neonates was slower in onset and less severe in effect than 0.5 i.u./kg in the older foals. There was a significant inverse correlation between the concentrations of glucose and adrenaline (but not noradrenaline) in plasma once the glucose level had fallen below 2 mmol/l; the adrenergic response to hypoglycaemia was greater in the 7-14-day-old foals than...
Rush BR, Raub ES, Thomsen MM, Davis EG, Matson CJ, Hakala JE.To evaluate clinical response, pulmonary function, and adrenal gland response to incremental doses of beclomethasone dipropionate in horses with recurrent airway obstruction. Methods: Crossover trial. Methods: 8 horses with recurrent airway obstruction. Methods: Horses randomly assigned to 4 groups were treated twice daily via aerosol administration of placebo or 500, 1,000, or 1,500 micrograms of beclomethasone dipropionate in a crossover design with a 10-day minimum washout period. Subjective assessment of airway obstruction, serum cortisol concentration, and maximum change in pleural pressu...
Padalino B, Rogers CW, Guiver D, Bridges JP, Riley CB.Transport-related problem behaviors (TRPBs) are common in horses and can cause injury to both the horses and their handlers. This study aimed to identify possible risk factors for TRPBs to inform approaches to mitigate TRPBs incidence and enhance horse welfare. An online cross-sectional survey was conducted to explore the prevalence of TRPBs and their association with human-, training- and transport management-related factors in New Zealand. The survey generated 1124 valid responses that were analyzed using descriptive statistics, and logistic regression analyses. Having at least one horse wit...
Faleiros RR, Johnson PJ, Nuovo GJ, Messer NT, Black SJ, Belknap JK.While there is evidence of laminar leukocyte infiltration in black walnut extract (BWE)-induced laminitis, there is no such evidence for carbohydrate overload (CHO) laminitis. Objective: To assess presence of leukocytes and signs of epidermal stress/injury in the laminar tissue from horses with CHO-induced laminitis. Methods: Twenty-four adult horses. Methods: Immunohistochemistry for myeloid cell markers calprotectin (CP) and monocyte-specific marker (CD163) was performed on laminar sections obtained from 2 groups of horses in the CHO model: the developmental time point (DTP) group (n = 6) an...
Layman QD, Rezabek GB, Ramachandran A, Love BC, Confer AW.Several Actinobacillus spp. are common commensal bacteria of the oral cavity, gastrointestinal tract, and reproductive tract of horses and can cause disease in both foals and adults. The current retrospective study was designed to review Actinobacillus spp. isolated from clinical samples or necropsies of 99 horses during 1999-2011. The cases consisted of 43 foals (2 years of age), 2 aborted fetuses, and 11 with unspecified ages. Clinical history, signs, bacterial species isolated, and associated lesions were documented. Actinobacillus spp. were isolated 111 times. The most common isolates were...
Fazio F, Gugliandolo E, Nava V, Piccione G, Giannetto C, Licata P.The objective of this study was to evaluate the levels and the potential bioaccumulation of vanadium (V), chromium (Cr), cobalt (Co), copper (Cu), zinc (Zn), cadmium (Cd), lead (Pb), and bismuth (Bi) in horses from the industrial risk area of Sicily (Italy). Different biological substrates (whole blood, serum; tail and mane) and samples of hay, concentrate and water provided to the horses were processed by means of Thermo Scientific iCAP-Q ICP-MS spectrometer for mineral concentration. One-way analysis of variance (ANOVA) was applied to show the differences in various trace elements in the bio...
Rogers CW, Firth EC, McIlwraith CW, Barneveld A, Goodship AE, Kawcak CE, Smith RK, van Weeren PR.No data exist on the effects of conditioning exercise at foal age on workload and subsequent clinical injury rate during their 2- and 3-year-old racing careers. Objective: To investigate the effects of subjecting TB foals to conditioning exercise prior to the start of race training on: the workload required to reach a level of fitness sufficient to compete; and the prevalence of orthopaedic injury during the first 2 seasons of their racing careers. Methods: Twenty 18-month-old TBs, 12 subjected to conditioning exercise at foal age (CONDEX) and 8 exercised spontaneously at pasture only (PASTEX)...
Jaworska J, Janowski T.Retained fetal membranes (RFM) is a prevalent postpartum disease in mares. During parturition, various proinflammatory cytokines are released in the placenta, which further facilitates uterine contractions, expulsion of the fetus and fetal membranes. We hypothesized that an altered inflammatory response in mares results in retained fetal membranes. Samples of the endometrium and the allantochorion were collected from 15 mares with RFM and from 29 control mares within 2 h of foal delivery. Next, the mRNA expression of IL-1β, IL-6 and TNFα proteins was analyzed by Real Time PCR and Western b...
Weishaupt MA, Waldern NM, Amport C, Ramseier LC, Wiestner T.To enhance expressiveness of forelimb movement and improve the four-beat rhythm of the tölt, Icelandic horses are commonly ridden with excessively high and long hooves. The aim of this study was to objectively assess the effect of shoeing on intra- and inter-limb coordination and limb movement consistency (inter-stride variability) at walk, tölt and trot. Thirteen sound and fit Icelandic horses accustomed to exercise with a rider on a treadmill were assessed with long and high hooves commonly used for competition (S(H)) and with the hooves trimmed according to the standards of normal shoeing...
Duru S.The aim of this study was to evaluate genetic variability in the Turkish Arab horse population using pedigree information. This study is the first detailed pedigree analysis of the breed in Turkey. Pedigree data were collected from the National Studbook. The pedigree data for 23 668 horses, born between 1904 and 2014, were used in the analysis. From this data set, a reference population (RP) of 14 838 animals symbolising the last generation was defined. Demographic parameters, the inbreeding level (F), the average relatedness (AR), the effective population size (N e), the effective number of f...
Trumble TN, Brown MP, Merritt KA, Billinghurst RC.Validate use of a commercially available immunoassay for measurement of bone alkaline phosphatase (BAP) in equine serum and synovial fluid (SF), and investigate the effects of osteochondral (OC) injury in horses on BAP concentrations in serum and SF. Methods: SF was collected from 37 joints of 34 Thoroughbred (TB) racehorses undergoing arthroscopic surgery for the removal of OC fragments from either the carpal joints (n=18) or the metacarpo-/metatarsophalangeal (MP) joints (n=19). SF was also obtained from 52 joints of 16 normal TB horses, collected bilaterally from carpal joints of 10 horses ...
Patton JF, Balasuriya UB, Hedges JF, Schweidler TM, Hullinger PJ, MacLachlan NJ.An avirulent, novel variant of equine arteritis virus (EAV; CA95G) was isolated from the semen of a persistently infected Standardbred stallion. The CA95G virus caused subclinical infection and seroconversion in susceptible horses, and virus was isolated only once from blood and nasal secretions collected from 6 experimentally infected horses. Sequence analysis of genes encoding the known EAV structural proteins shows that this highly attenuated strain of EAV is genetically similar to virulent field strains of EAV and, in particular, to a strain of EAV that was isolated during an outbreak of e...
Sides RH, Kirkpatrick R, Renner E, Gough K, Katz LM, Evans DL, Bayly WM.The need for a horse to be ridden while wearing a measurement device that allows unrestricted ventilation and gas exchange has hampered accurate measurement of its maximal oxygen consumption (V̇O max) under field conditions. Objective: Design and validate a facemask with the potential to measure V̇O max accurately in the field. Methods: Experiment with 6 × 6 Latin square design. Methods: Two variations of a mask and associated electronic control module (ECM) were designed to enable breath-by-breath measurement of airflows through two 7.8 cm diameter pneumotachometers located 7.5 cm in front...
Cohen ND, Slovis NM, Giguère S, Baker S, Chaffin MK, Bernstein LR.Macrolide-resistant isolates of Rhodococcus equi are emerging, prompting the search for clinically effective alternative antimicrobials. Objective: The proportion of foals with ultrasonographic evidence of pneumonia presumed to be caused by R. equi that had a successful outcome when administered gallium maltolate (GaM) PO would not be more than 10% inferior (ie, lower) than that of foals receiving standard treatment. Methods: Fifty-four foals with subclinical pulmonary abscesses among 509 foals at 6 breeding farms in Kentucky. Methods: Controlled, randomized, prospective noninferiority study. ...
Reilly GC, Currey JD, Goodship AE.Exercise can have a profound effect on bone mass, but little is known of its effect on bone's material properties. In this experiment, our hypothesis was that a large difference in the training regimen of young thoroughbreds would produce a measurable difference in the mechanical properties of their bone material. When they were about 19 months old, eight thoroughbred racehorses were given one of two exercise regimens that lasted for 19 weeks: four horses (controls) were walked for 40 minutes a day but had no other exercise, and the remaining four (exercised) were additionally trotted for 20 m...
The Journal of parasitologyJuly 26, 2003
Volume 89, Issue 3 604-606 doi: 10.1645/0022-3395(2003)089[0604:CKACAP]2.0.CO;2
Bork S, Yokoyama N, Matsuo T, Claveria FG, Fujisaki K, Igarashi I.The antifungal agents clotrimazole (CLT) and ketoconazole (KC) and the herbicide clodinafop-propargyl (CP) inhibit growth of Plasmodium sp., Toxoplasma sp., and Trypanosoma sp. In the present study, we evaluated these drugs against the in vitro growth of the equine protozoan parasites Babesia equi and B. caballi. Clotrimazole (IC50: 2 and 17 microM), KC (IC50: 6 and 22 microM), and CP (IC50: 450 and 354 microM) were effective growth inhibitors. Interestingly, intraerythrocytic KC-treated Babesia sp. were observed to be in immediate contact with the plasma fraction of the blood in electron micr...
Al-Essawe EM, Johannisson A, Wulf M, Aurich C, Morrell JM.Addition of seminal plasma (SP) prior to cryopreservation may influence stallion sperm cryosurvival. The objective of this study was to investigate the addition of pooled SP from "good" or "bad" freezer stallions to spermatozoa selected by single layer centrifugation (SLC) prior to cryopreservation on post-thaw sperm quality. Semen from 12 stallions was collected; 5 mL was frozen as control (C) and the remainder was processed by SLC to remove SP and was divided into three aliquots: i) SLC sample without SP (SLC); ii) SLC plus pooled SP from "good freezer" stallions (SLC-GF); iii) SLC plus po...
Maeda Y, Oikawa MA.Shipping Fever is a transport associated syndrome seen in equids and bovines transported during long distances. The microbial profile and clinical signs vary between species, and in horses it is characterized by pharyngeal commensal bacteria and aerosolized particulate matter invading the lower airway due to compromised mucocillary clearance mechanisms during transports. This leads to pyrexia, pulmonary parenchymal disease, inappetence, and in severe cases pleuropneumonia. It has been shown that the incidence of transport-related pyrexia in horses increases with travel time and distance, howev...
Borgsteede FH, van Beek G.The prevalence of metazoan parasites in the stomach and small intestine was investigated in 70 horses slaughtered in the period February 1994-July 1994. Most horses were young (1.5-3 years) and in good condition. Trichostrongylus axei was the most prevalent parasite species in the stomach (51.4%), followed by Gasterophilus intestinalis (41.4%) and Habronema spp. (4.3%). In the small intestine, Parascaris equorum (28.6%) and Paranoplocephala mamillana (1.4%) were found. The mean worm burden of T. axei was 957 (max. 8502), of G. intestinalis 21 (max. 84), of Habronema spp. 3 (max. 5), and of P. ...
Mustikka MP, Grönthal TSC, Pietilä EM.To retrospectively describe laboratory findings, treatment, and outcome associated with equine infectious keratitis in Finland. Unassigned: Medical records of horses diagnosed with infectious keratitis in University of Helsinki Equine Hospital from January 2007 to June 2018 were reviewed. Results: Forty-seven cases were included. Keratomycosis was diagnosed in 27 eyes and bacterial keratitis in 20 eyes. Aspergillus flavus was the most frequent fungal isolate (9/17, 53%), followed by Cylindrocarpon sp. (3/17, 18%) and Aspergillus fumigatus (2/17, 12%). Susceptibility was tested for 10/11 Asperg...
Bartolomé E, Menéndez-Buxadera A, Molina A, Valera M.To obtain a sport horse that excels in the highest levels of competition, breeders must take into account certain genetic and environmental factors that could influence the sport horse's performance, such as the rider-horse interaction (RHI). The main aim of this study was to describe this interaction in a genetic model by modelling it in relation to the horse's age. A total of 31,129 sport results from Spanish Sport Horses were used from a total of 1,101 animals evaluated, and these were grouped in three age levels and had been ridden by 606 different riders. Only riders who had ridden more t...
Dacre IT, Kempson S, Dixon PM.Morphological examinations were performed on 100 normal equine cheek teeth (CT) of 1-12 years dental age (i.e. time since eruption), using gross examination, dissection microscopy, computerised axial tomography, and decalcified and undecalcified histology. The CT in Triadan 07-10 positions consistently had five pulp horns, but the 06 CT had an additional pulp horn more rostrally. Mandibular and maxillary Triadan 11s had six and seven pulp horns, respectively. Sections of CT taken 2-6mm below the occlusal surface (variation due to normal undulating occlusal surface) showed the presence of pulp ...
Smith AW, Vedros NA, Akers TG, Gilmartin WG.In a 5-year study (1972-1977) of microbial agents isolated from both clinically normal and diseased marine mammals, it was shown that certain disease agents are widespread in a diversity of ocean populations and that some are also transmissible to a number of terrestrial mammal species. Leptospira interrogans serovar pomona has been isolated repeatedly from 2 species of pinnipeds (Zalophus californianus califonianus and Callorhinus ursinus). Some of the more important bacterial pathogens for land mammals that were isolated from wild marine mammals are Pseudomonas mallei, Clostridium chauvoei, ...
Blikslager AT.Management factors associated with colic, particularly related to stall confinement and nutrition, have been linked to alterations in gastrointestinal mucosal transport, motility, and microbiome, which in turn creates conditions that induce colic. In particular, meal feeding creates large changes in water movement in and out of the colon and alters the microbiome. These conditions may in turn result in colic conditions such as large colon impaction or large colon volvulus. In addition, a range of management and nutritional factors have been found to place horses at risk of select colic conditi...
McMichael M, Goggs R, Smith S, Wagg C, Warman S, Wiinberg B.To systematically examine the evidence on system comparability between the thromboelastography and the rotational thromboelastometry viscoelastic point-of-care instruments and to identify knowledge gaps. Methods: Standardized, systematic evaluation of the literature, categorization of relevant articles according to level of evidence and quality, and development of consensus on conclusions for application of the concepts to clinical practice. Methods: Academic and referral veterinary medical centers. Results: Medline via PubMed, CAB abstracts, and Google Scholar were searched. A total of 8 rele...
Liu LL, Fang C, Liu WJ.The utility of high-density single nucleotide polymorphism (SNP) data help to accurately identify genomic regions that have undergone positive selection. In this study, the Affymetrix Equine 670 K high-density SNP array was used to genotype Kazakh and Yili horse population. After quality control, 370,227 autosomal SNPs were used to detect selection signatures by using global fixation index (F) and cross-population extended haplotype homozygosity (XP-EHH). The database of Ensemble, Genecards, and NCBI were used to make gene annotation and functional analysis. The results showed that there wer...
Muir WW, Skarda RT, Milne DW.An evaluation and comparison of thermodilution technique with dye dilution technique was made in the computation of cardiac output in 39 conscious adult horses (av body wt, 450 kg). Estimation of cardiac output by thermodilution was found to compare favorably with values obtained from dye dilution when a volume of 30 to 40 ml at a temperature of 0 C was used. Difficulties in obtaining accurate thermodilution curves in the horse seem predominantly associated with errors in mixing and observation.
