Analyze Diet

Topic:Genetics

Genetics in horses encompasses the study of hereditary traits and the genetic makeup that influences various characteristics and health conditions in equine populations. This field involves the analysis of genes and their functions, inheritance patterns, and the impact of genetic variations on traits such as coat color, performance ability, and susceptibility to diseases. Research in equine genetics employs techniques such as genome mapping, sequencing, and genetic testing to identify specific genes and mutations associated with these traits. This page gathers peer-reviewed research studies and scholarly articles that explore the genetic basis of equine traits, the methodologies used in genetic research, and the implications for breeding, health management, and conservation of horse breeds.
Relationship between DNA fragmentation of equine granulosa cells and oocyte meiotic competence after in vitro maturation.
Reproduction in domestic animals = Zuchthygiene    October 19, 2019   Volume 54 Suppl 4 78-81 doi: 10.1111/rda.13514
Pereira B, Dorado J, Diaz-Jimenez M, Consuegra C, Ortiz I, Gosalvez J, Hidalgo M.The acquisition of equine oocyte developmental capacity is ensured by the follicular environment, such as granulosa cells, which could reflect the meiotic development potential of immature oocytes. This study evaluated the relationship between DNA fragmentation of granulosa cells, using the chromatin dispersion test, and equine oocyte meiotic development after in vitro maturation. Granulosa cells and cumulus-oocytes complexes (n = 50) were recovered from slaughterhouse-derived ovaries. Oocytes were in vitro matured, stained and evaluated under fluorescence microscopy. Maturation rates were c...
Frameshift Variant in MFSD12 Explains the Mushroom Coat Color Dilution in Shetland Ponies.
Genes    October 19, 2019   Volume 10, Issue 10 826 doi: 10.3390/genes10100826
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Non-Coding RNA Sequencing of Equine Endometrium During Maternal Recognition of Pregnancy.
Genes    October 18, 2019   Volume 10, Issue 10 821 doi: 10.3390/genes10100821
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Characterization of abortion, stillbirth and non-viable foals homozygous for the Warmblood Fragile Foal Syndrome.
Animal reproduction science    October 17, 2019   Volume 211 106202 doi: 10.1016/j.anireprosci.2019.106202
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Unravelling the hybrid vigor in domestic equids: the effect of hybridization on bone shape variation and covariation.
BMC evolutionary biology    October 15, 2019   Volume 19, Issue 1 188 doi: 10.1186/s12862-019-1520-2
Hybridization has been widely practiced in plant and animal breeding as a means to enhance the quality and fitness of the organisms. In domestic equids, this hybrid vigor takes the form of improved physical and physiological characteristics, notably for strength or endurance. Because the offspring of horse and donkey is generally sterile, this widely recognized vigor is expressed in the first generation (F1). However, in the absence of recombination between the two parental genomes, F1 hybrids can be expected to be phenotypically intermediate between their parents which could potentially restr...
Clonal Confinement of a Highly Mobile Resistance Element Driven by Combination Therapy in Rhodococcus equi.
mBio    October 15, 2019   Volume 10, Issue 5 e02260-19 doi: 10.1128/mBio.02260-19
Álvarez-Narváez S, Giguère S, Anastasi E, Hearn J, Scortti M, Vázquez-Boland JA.Antibiotic use has been linked to changes in the population structure of human pathogens and the clonal expansion of multidrug-resistant (MDR) strains among healthcare- and community-acquired infections. Here we present a compelling example in a veterinary pathogen, , the causative agent of a severe pulmonary infection affecting foals worldwide. We show that the (46) gene responsible for emerging macrolide resistance among equine isolates in the United States is part of a 6.9-kb transposable element, Tn, actively mobilized by an IS family transposase. Tn is carried on an 87-kb conjugative pla...
The First Detection of Equine Coronavirus in Adult Horses and Foals in Ireland.
Viruses    October 14, 2019   Volume 11, Issue 10 946 doi: 10.3390/v11100946
Nemoto M, Schofield W, Cullinane A.The objective of this study was to investigate the presence of equine coronavirus (ECoV) in clinical samples submitted to a diagnostic laboratory in Ireland. A total of 424 clinical samples were examined from equids with enteric disease in 24 Irish counties between 2011 and 2015. A real-time reverse transcription polymerase chain reaction was used to detect ECoV RNA. Nucleocapsid, spike and the region from the p4.7 to p12.7 genes of positive samples were sequenced, and sequence and phylogenetic analyses were conducted. Five samples (1.2%) collected in 2011 and 2013 tested positive for ECoV. Po...
A candidate-SNP retrospective cohort study for fracture risk in Japanese Thoroughbred racehorses.
Animal genetics    October 14, 2019   Volume 51, Issue 1 43-50 doi: 10.1111/age.12866
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Localisation of phospholipase Cζ1 (PLCZ1) and postacrosomal WW-binding protein (WBP2 N-terminal like) on equine spermatozoa and flow cytometry quantification of PLCZ1 and association with cleavage in vitro.
Reproduction, fertility, and development    October 11, 2019   Volume 31, Issue 12 1778-1792 doi: 10.1071/RD19217
Gonzalez-Castro RA, Amoroso-Sanches F, Stokes JE, Graham JK, Carnevale EM.Oocyte activation is initiated when a fertilising spermatozoon delivers sperm-borne oocyte-activating factor(s) into the oocyte cytoplasm. Candidates for oocyte activation include two proteins, phospholipase Cζ1 (PLCZ1) and postacrosomal WW-binding protein (PAWP; also known as WBP2 N-terminal like (WBP2NL)). We localised PLCZ1 and WBP2NL/PAWP in stallion spermatozoa and investigated the PLCZ1 content and sperm parameters as well as cleavage after intracytoplasmic sperm injection (ICSI). PLCZ1 was identified as 71-kDa protein in the acrosomal and postacrosomal regions, midpiece and principal p...
Comparative Review of Asthma in Farmers and Horses.
Current allergy and asthma reports    October 10, 2019   Volume 19, Issue 11 50 doi: 10.1007/s11882-019-0882-2
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
Culture-independent and dependent evaluation of the equine paranasal sinus microbiota in health and disease.
Equine veterinary journal    October 10, 2019   Volume 52, Issue 3 455-463 doi: 10.1111/evj.13168
Beste KJ, Lawhon SD, Chamoun-Emanuelli AM, Duff AH, Coleman MC, Griffin CE, Hardy J, Whitfield-Cargile CM.Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...
Development of the equine gut microbiota.
Scientific reports    October 8, 2019   Volume 9, Issue 1 14427 doi: 10.1038/s41598-019-50563-9
Lindenberg F, Krych L, Kot W, Fielden J, Frøkiær H, van Galen G, Nielsen DS, Hansen AK.Shortly after birth the mammalian gut is colonized, by a transient microbiota, highly susceptible to environment and diet, that eventually stabilizes and becomes the resident gut microbiota. In a window of opportunity during the colonization, oral tolerance is established towards resident bacteria. In this study, the development of the equine gut microbiota was investigated in ten foals from parturition until post weaning. We found great differences in the core species of the gut microbiota composition between time-matched samples on Day 7 and 20 post-partum. Between day 20 and Day 50 post-par...
Relationships between antral follicle count, blood serum concentration of anti-Müllerian hormone and fertility in mares.
Schweizer Archiv fur Tierheilkunde    October 7, 2019   Volume 161, Issue 10 627-638 doi: 10.17236/sat00225
Traversari J, Aepli H, Knutti B, Lüttgenau J, Bruckmaier RM, Bollwein H.The anti-Müllerian hormone (AMH) plays an inhibitory role during folliculogenesis by regulating the number of follicles entering the growing pool. Antral follicle counts (AFC) are highly correlated with serum AMH concentrations and both appear to be related to the ovarian reserve in several species. Few data on AMH and AFC in mares exist, especially with regard to fertility. Therefore, the objective of the current study was to investigate the interrelationship between antral follicle count, serum AMH concentrations and fertility outcome in mares. One hundred and twenty-seven mares were enroll...
Clinical insights: The equine microbiome.
Equine veterinary journal    October 5, 2019   Volume 51, Issue 6 714-715 doi: 10.1111/evj.13165
Murcia PR.No abstract available
Targeting epigenetic nuclear reprogramming in aggregated cloned equine embryos.
Reproduction, fertility, and development    October 5, 2019   Volume 31, Issue 12 1885-1893 doi: 10.1071/RD19239
Damasceno Teixeira TV, Fry RC, McKinnon A, Fry KL, Kelly JM, Verma PJ, Burden C, Salamone DF, Gambini A.Epigenetic perturbations during the reprogramming process have been described as the primary cause of the low efficiency of somatic cell nuclear transfer (SCNT). In this study, we tested three strategies targeting nuclear reprogramming to investigate effects on equine SCNT. First, we evaluated the effect of treating somatic cells with chetomin, a fungal secondary metabolite reported to inhibit the trimethylation on histone 3 lysine 9 (H3K9 me3). Second, caffeine was added to the culture medium during the enucleation of oocytes and before activation of reconstructed embryos as a protein phospha...
Multifocal outbreak of equine influenza in vaccinated horses in Argentina in 2018: Epidemiological aspects and molecular characterisation of the involved virus strains.
Equine veterinary journal    October 4, 2019   Volume 52, Issue 3 420-427 doi: 10.1111/evj.13176
Olguin-Perglione C, Vissani MA, Alamos F, Tordoya MS, Barrandeguy M.Equine influenza is an important cause of respiratory disease of horses worldwide. The equine influenza virus (EIV) undergoes antigenic drift through the accumulation of amino acid substitutions in the viral proteins, which may lead to vaccine breakdown. Objective: To describe the epidemiological findings and the molecular characteristics of the EIV detected during the multifocal outbreak that occurred in Argentina between March and July 2018 and evidence a vaccine breakdown. Methods: Observational, descriptive study. Methods: Virus was detected in nasopharyngeal swabs using real-time reverse ...
Molecular Surveillance of EHV-1 Strains Circulating in France during and after the Major 2009 Outbreak in Normandy Involving Respiratory Infection, Neurological Disorder, and Abortion.
Viruses    October 4, 2019   Volume 11, Issue 10 916 doi: 10.3390/v11100916
Sutton G, Garvey M, Cullinane A, Jourdan M, Fortier C, Moreau P, Foursin M, Gryspeerdt A, Maisonnier V, Marcillaud-Pitel C, Legrand L, Paillot R....Equine herpesvirus 1 (EHV-1) is an Alphaherpesvirus infecting not only horses but also other equid and non-equid mammals. It can cause respiratory distress, stillbirth and neonatal death, abortion, and neurological disease. The different forms of disease induced by EHV-1 infection can have dramatic consequences on the equine industry, and thus the virus represents a great challenge for the equine and scientific community. This report describes the progress of a major EHV-1 outbreak that took place in Normandy in 2009, during which the three forms of disease were observed. A collection of EHV-1...
Warmblood fragile foal syndrome type 1 mutation (PLOD1 c.2032G>A) is not associated with catastrophic breakdown and has a low allele frequency in the Thoroughbred breed.
Equine veterinary journal    October 4, 2019   Volume 52, Issue 3 411-414 doi: 10.1111/evj.13182
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
The Interaction Between Nodal, Hypoxia-Inducible Factor 1 Alpha, and Thrombospondin 1 Promotes Luteolysis in Equine Corpus Luteum.
Frontiers in endocrinology    October 1, 2019   Volume 10 667 doi: 10.3389/fendo.2019.00667
Walewska E, Wołodko K, Skarzynski D, Ferreira-Dias G, Galvão A.The regulation of corpus luteus (CL) luteolysis is a complex process involving a myriad of factors. Previously, we have shown the involvement of Nodal in functional luteolysis in mares. Presently, we ask the extent of which Nodal mediation of luteolysis is done through regulation of angioregression. We demonstrated the interaction between Nodal and hypoxia-inducible factor 1 α (HIF1α) and thrombospondin 1/thrombospondin receptor (TSP1/CD36) systems, could mediate angioregression during luteolysis. First, we demonstrated the inhibitory effect of Nodal on the vascular marker platelet/endotheli...
Ten years of the horse reference genome: insights into equine biology, domestication and population dynamics in the post-genome era.
Animal genetics    September 30, 2019   Volume 50, Issue 6 569-597 doi: 10.1111/age.12857
Raudsepp T, Finno CJ, Bellone RR, Petersen JL.The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromer...
Effect of inbreeding on the “Club Foot” disorder in Arabian Pureblood horses reared in Italy.
Open veterinary journal    September 29, 2019   Volume 9, Issue 3 273-280 doi: 10.4314/ovj.v9i3.14
Comparini L, Podestà A, Russo C, Cecchi F."The Club Foot" (or "Mismatched Foot") is an acquired or congenital flexural deformity of the distal interphalangeal joint, caused by a shortening of the musculotendinous unit of the deep digital flexor tendon. The aim of this research was to detect the incidence of the disorder in Arabian Pureblood horses, attempting to understand its causes and to analyze a possible role of inbreeding in its expression. In this breed, in fact, the pathology is widespread because in the environment of origin, the rocky desert, a hard and almost goat's hoof is not disabling so the selection against this disord...
Differential Gene Expression in Articular Cartilage and Subchondral Bone of Neonatal and Adult Horses.
Genes    September 25, 2019   Volume 10, Issue 10 745 doi: 10.3390/genes10100745
Kemper AM, Drnevich J, McCue ME, McCoy AM.Skeletogenesis is complex and incompletely understood. Derangement of this process likely underlies developmental skeletal pathologies. Examination of tissue-specific gene expression may help elucidate novel skeletal developmental pathways that could contribute to disease risk. Our aim was to identify and functionally annotate differentially expressed genes in equine neonatal and adult articular cartilage (AC) and subchondral bone (SCB). RNA was sequenced from healthy AC and SCB from the fetlock, hock, and stifle joints of 6 foals (≤4 weeks of age) and six adults (8-12 years of age). There w...
Genetic parameters and estimated breeding values for traits of raw and frozen-thawed semen in German Warmblood stallions.
Animal reproduction science    September 23, 2019   Volume 210 106194 doi: 10.1016/j.anireprosci.2019.106194
Greiser T, Sieme H, Martinsson G, Distl O.Objectives of the present study were to estimate genetic parameters for frozen-thawed semen traits of 271 fertile German Warmblood stallions and genetic correlations with raw semen quality traits. Semen samples were collected from stallions utilized for semen collection and artificial insemination (AI) on the Lower Saxon National Stud Celle and the North Rhine-Westphalian National Stud Warendorf. Semen quality variables were analyzed in 63,972 raw (gel-free volume, concentration, progressive motility, number of sperm) and 3681 frozen-thawed samples (motility, DNA fragmentation index (DFI), non...
Letter to the Editor: Is it time to replace the term ‘endometrosis’?
Equine veterinary journal    September 23, 2019   Volume 52, Issue 1 160 doi: 10.1111/evj.13172
Khan FA, Chenier TS.No abstract available
Exploring the genetics underpinning dynamic laryngeal collapse associated with poll flexion in Norwegian-Swedish Coldblooded Trotter racehorses.
Equine veterinary journal    September 23, 2019   Volume 52, Issue 2 174-180 doi: 10.1111/evj.13171
Velie BD, Smith PM, Fjordbakk CT, Solé M, Jäderkvist Fegraeus K, Rosengren MK, Røed KH, Ihler CF, Lindgren G, Strand E.Dynamic laryngeal collapse (DLC) associated with poll flexion is the most common disorder of the upper respiratory tract (URT) in the Norwegian-Swedish Coldblooded Trotter (NSCT). The disorder, which has also been diagnosed in other breeds of trotters and gaited horses, appears to be related to anatomic phenotypes and only occurs during poll flexion when the horse is exercised 'on the bit'. Objective: Identify genomic regions associated with DLC in the NSCT by combining a rigorous phenotyping protocol with genomic data from a high-density equine genotyping array. Methods: Prospective case/cont...
Equine digital tendons show breed-specific differences in their mechanical properties that may relate to athletic ability and predisposition to injury.
Equine veterinary journal    September 23, 2019   Volume 52, Issue 2 320-325 doi: 10.1111/evj.13169
Verkade ME, Back W, Birch HL.Throughout the ages, human subjects have selected horse breeds for their locomotor capacities. Concurrently, tissue properties may have diversified because of specific requirements of different disciplines. Objective: The aim of this study was to compare the biomechanical properties of tendons with different functions between equine breeds traditionally selected for racing or sport. Methods: This study used ex vivo tendons and compared the mechanical properties of the common digital extensor tendon (CDET) and superficial digital flexor tendon (SDFT) between racehorses (Thoroughbred [TB]) and s...
A case study of vertebral fusion in a 19th-century horse from Serbia.
International journal of paleopathology    September 21, 2019   Volume 27 17-23 doi: 10.1016/j.ijpp.2019.07.007
To evaluate the etiology of skeletal changes noted in equid vertebrae from a 19- century context near Belgrade, Serbia. A vertebral column consisting of 15 fused thoracic vertebrae (T2-T16), with right ribs fused to T4 and T5 and small remnants of ribs articulating with T4, T5 and T6 on the left side were accidentally recovered during industrial exploitation of sand. The specimen was subjected to morphological analysis and collagen fingerprinting by mass spectrometry for species identification. In order to determine the absolute temporal context, radiocarbon dating was employed. Pathological c...
Complete Genome Sequence of Escherichia coli Podophage Penshu1.
Microbiology resource announcements    September 19, 2019   Volume 8, Issue 38 e01055-19 doi: 10.1128/MRA.01055-19
Pechacek D, Hwangbo M, Moreland R, Liu M, Ramsey J. 4s is a Gram-negative bacterium found in the equine intestinal ecosystem alongside diverse other coliform bacteria and bacteriophages. This announcement describes the complete genome of the T7-like 4s podophage Penshu1. From its 39,263-bp genome, 54 protein-encoding genes and a 179-bp terminal repeat were predicted.
Breed and stallion effects on frozen-thawed semen in warmblood, light and quarter horses.
Theriogenology    September 19, 2019   Volume 142 8-14 doi: 10.1016/j.theriogenology.2019.09.033
Greiser T, Sieme H, Martinsson G, Distl O.The objectives of the present study were to analyze systematic effects on semen quality traits from fresh and frozen-thawed semen collected in and outside season. A total of 4,681 reports on semen traits of 121 stallions representing Arabian, Thoroughbred, Quarter Horse and four warmblood breeds used for artificial insemination at the Lower Saxon National stud Celle were edited for analysis of gel-free volume, sperm concentration, total number of sperm and total number of motile sperm in fresh semen and in frozen-thawed semen progressive motility, DNA fragmentation index and non-viable sperm. ...
1 54 55 56 57 58 331