"Horses" is a broad topic that encompasses various aspects of equine biology, behavior, and management. This category includes studies on the anatomy, physiology, and genetics of horses, as well as their behavior, nutrition, and care. Research in this area may also cover the historical and cultural significance of horses, their roles in agriculture, sport, and therapy, and the challenges associated with their conservation and welfare. The page aggregates peer-reviewed research articles and scholarly studies that explore the multifaceted relationships between humans and horses, examining both scientific and socio-economic perspectives.
Boldbaatar D, Xuan X, Battsetseg B, Igarashi I, Battur B, Batsukh Z, Bayambaa B, Fujisaki K.The purpose of this study was to demonstrate the occurrence of equine piroplasmosis in Mongolia, a country in which the disease occurs epidemically in different climatic conditions. Antibodies to Babesia equi and B. caballi were determined in serum samples of 254 pastured horses in different locations of Mongolia using an enzyme-linked immunosorbent assay with recombinant antigens. One hundred and eighty-five (72.8%) and 102 (40.1%) of all serum samples were positive for B. equi and B. caballi infections, respectively. In addition, 78 (30.7%) samples were positive for both B. equi and B. cabal...
Rossano MG, Schott HC, Murphy AJ, Kaneene JB, Sellon DC, Hines MT, Hochstatter T, Bell JA, Mansfield LS.Equine protozoal myeloencephalitis (EPM) is a serious neurological disease of horses in Americans. Most cases are attributed to infection of the central nervous system with Sarcocystis neurona. Parasitemia has not been demonstrated in immunocompetent horses, but has been documented in one immunocompromised foal. The objective of this study was to isolate viable S. neurona from the blood of immunocompetent horses. Horses used in this study received orally administered S. neurona sporocysts (strain SN 37-R) daily for 112 days at the following doses: 100/day for 28 days, followed by 500/day for 2...
Obregón AM, Fernández C, Rodríguez I, Balbis Y, Martínez B, Rodríguez J.To assess the sensitivity, specificity, reproducibility, and stability of five latex agglutination systems for detecting antibodies against leptospira in human and animal sera, by using the Leptospira serotypes that are most widely prevalent in Cuba. Methods: We performed an analytic and descriptive study with 706 human sera (65 tested positive for antibodies against leptospira with microagglutination (MAT) and hemagglutination (HA) techniques; 156 sera that tested negative with MAT and HA); 485 sera from 424 patients who had clinical or epidemiologic signs of leptospirosis; and 29 animal sera...
Macleod KD, Scott DW, Erb HN.A retrospective study was performed to assess the prevalence of apoptotic epidermal keratinocytes in biopsy specimens from 226 horses with inflammatory dermatoses and from 27 normal specimens. One or more apoptotic keratinocytes were found in specimens from 28 of 226 (12%) horses with various dermatoses, and in one of 27 (4%) specimens from normal horses. The prevalence (proportion of cases with apoptotic epidermal keratinocytes) of apoptotic keratinocytes in the group composed of discoid lupus erythematosus, erythema multiforme, photodermatitis, and systemic lupus erythematosus was significan...
Payne RC, Veenman P, Wilson AM.Muscles have two major roles in locomotion: to generate force and to absorb/generate power (do work). Economical force generation is achieved by short-fibred pennate muscle while the maximum power output of a muscle is architecture independent. In this study we tested the hypothesis that there is an anatomical and structural separation between the force-generating anti-gravity muscles and the propulsive (limb/trunk moving) muscles of the equine forelimb. Muscle mass and fascicle length measurements were made on the thoracic limb extrinsic muscles of six fresh horse cadavers. Physiological cros...
Boyde A, Firth EC.We describe morphological aspects of the articular calcified cartilage mineralizing front 'tidemark' in the distal joint surface of the third metacarpal bone from 14 horses. Compositional backscattered electron scanning electron microscopy and confocal scanning light microscopy were conducted on polymethylmethacrylate (PMMA)-embedded medio-lateral slices. After maceration, scanning electron microscopy (SEM) was used to study the calcified cartilage surface in the 'wedges' intervening between the slices. An anatomically reproducible clustering of canals in the calcified cartilage was found at o...
Górecka A, Jezierski TA, Słoniewski K.Weak or equivocal expression of oestrous behaviour, related to different level of mares' reactivity, may cause problems in oestrus detection and thus influence the reproductive efficiency. The aim of the study was to test whether a breed characterised by low pregnancy rate and high emotional reactivity (Thoroughbreds) differs in oestrous behaviour from a primitive breed with higher reproductive efficiency (Koniks). Additionally, the follicle size was examined to determine how it influences the intensity of oestrus and uterine ultrasonic image and whether the pregnancy rate differs in relation ...
Palencia P, Quiroz-Rothe E, Rivero JL.Equine motor neuron disease (EMND) is a neurodegenerative disorder similar to the sporadic form of human amyotrophic lateral sclerosis. This study was conducted to quantify myofiber plasticity in response to EMND. Deep M. gluteus medius biopsy samples from eight horses with an ante mortem diagnosis of EMND, which in five cases was later confirmed by post mortem examination of spinal cord and peripheral nerves, were examined by combined methodologies of electrophoresis of myosin heavy chains (MyHC), muscle enzymes and substrate biochemistry, immunohistochemistry of MyHCs and sarcoendoplasmic Ca...
Alber J, El-Sayed A, Lämmler C, Hassan AA, Weiss R, Zschöck M.The closely related streptococcal species Streptococcus equi subsp. zooepidemicus and S. equi subsp. equi were identified by polymerase chain reaction using oligonucleotide primers designed according to species-specific parts of the superoxide dismutase A encoding gene sodA. A further differentiation of both subspecies could be performed by amplification of the genes seeH and seeI encoding the exotoxins SeeH and SeeI, respectively, which could be detected for S. equi subsp. equi but not for S. equi subsp. zooepidemicus. A further simplification of the identification and differentiation of both...
Dixon PM, Andrew R, Brannon H, Burgess R, Gibson A, Little JC, Orange B, Ross L, Rudolph T, Shaw DJ.A survey of 854 horse owners, trainers and equestrian managers in 10 regions of Great Britain and Ireland showed that 83 per cent provided their horses with routine prophylactic dental care at fixed intervals, including 49 per cent at intervals of 12 months and 30 per cent at intervals of six months; a further 10 per cent provided it only when they felt it was required and 7 per cent did not provide it at all. Overall, 44 per cent of the owners had their horse's wolf teeth (first premolar) extracted routinely; when prophylactic dentistry was provided, it was carried out solely by equine dental...
Céleste C, Ionescu M, Robin Poole A, Laverty S.Although intraarticular (IA) corticosteroids are frequently used to treat joint disease, the effects of their repeated use on articular cartilage remains controversial. The aim of our study was to determine the effects of a clinically recommended dose of IA triamcinolone acetonide (TA), on synovial fluid (SF) biomarkers of cartilage metabolism. Ten adult horses, free of osteoarthritis (OA) in their radiocarpal joints, were studied. One radiocarpal joint of each horse was randomly chosen for treatment and the contralateral anatomically paired joint acted as the control. Aseptic arthrocentesis w...
Skiöldebrand E, Heinegård D, Eloranta ML, Nilsson G, Dudhia J, Sandgren B, Ekman S.The aim of the present study was to correlate the levels of COMP and aggrecan as indicators of tissue damage, in synovial fluid (sf) from carpal joints of acutely lame racehorses, with macroscopical lesions of articular cartilage (OA), osteochondral fractures and ligament tears found at arthroscopy. Sixty-three lame horses [49 Standardbred trotters (STB) and 14 Thoroughbreds (TB)] in conventional training and racing that underwent arthroscopy of their middle carpal or radiocarpal joints were included in the study. Intact as well as fragmented COMP and aggrecan released into the synovial fluid ...
Haupt JL, Frisbie DD, McIlwraith CW, Robbins PD, Ghivizzani S, Evans CH, Nixon AJ.This study evaluated the potential of gene induced synoviocyte expression of a combination of insulin-like growth factor-I (AdIGF-I) and interleukin-1 receptor antagonist protein (AdIL-1Ra) to control articular cartilage degradation in vitro. Cartilage explants and synovial membrane were harvested from young mature horses. Synovial monolayers were established and either (1) maintained as untransduced controls; (2) transduced with AdIGF-I at 200 MOI in 500 microl serum-free medium; (3) transduced with AdIL-1Ra at 100 MOI; or (4) transduced with a combination of AdIGF-I (200 MOI) and AdIL-1Ra (1...
McKnight AL, Manduca A, Felmlee JP, Rossman PJ, McGee KP, Ehman RL.Magnetic resonance imaging (MRI) of the distal extremities of the standing, sedated horse would be desirable if diagnostic quality images could be obtained. With the availability of extremity and special purpose magnet designs on the market, a system to safely accommodate the standing horse may gain increasing popularity. This paper considers the issue of motion that will need to be addressed to achieve successful, diagnostic quality images. The motion of the carpus and tarsus of five standing, sedated horses was quantified. The obtained motion records were then used to induce motion in cadave...
Beinlich CP, Nixon AJ.In this study, the radiographic and histologic appearance of lateral palmar intercarpal ligament (LPICL) avulsion in the horse was characterized. Thirty-seven horses with radiographic evidence of avulsion fragments originating from the medial palmar aspect of the ulnar carpal bone were examined. The dorsolateral to palmaromedial projection was useful for evaluating the size and shape of the avulsed bone fragment, and the dorsopalmar projection added information on the relative proximity of the fragment to its fracture bed. Radiographic features that differentiated LPICL avulsion from subchondr...
Chacon SC, Faccini JL, Bittencourt VR.The host relationships for most species of the genus Amblyomma are poorly known in Brazil. The ability of A. pseudoconcolor and A. cooperi to successfully feed on horses was investigated during ongoing research on the life cycle of these two species, which are primarily associated with wildlife. Results of these experiments suggest that horses are potential hosts for the adult stages of both species.
Silva LA, Fioravanti MC, Oliveira KS, Atayde IB, Andrade MA, Jayme VS, Rabelo RE, Romani AF, Araújo EG.The effectiveness of combining metacresolsufonic acid with streptomycin in the treatment of actinomycosis, diagnosed either clinically or in the laboratory, was evaluated in 12 bovines and 2 equines. Eighty-seven percent of treated animals were considered clinically cured and did not show any signs of relapse after a six-month follow-up period. Therapeutic diagnosis by clinical observation was the procedure of choice when it was not possible to obtain laboratory diagnosis.
Howe L, Craigo JK, Issel CJ, Montelaro RC.It has been previously reported that transient corticosteroid immune suppression of ponies experimentally infected with a highly neutralization resistant envelope variant of equine infectious anemia virus (EIAV), designated EIAV(DeltaPND), resulted in the appearance of type-specific serum antibodies to the infecting EIAV(DeltaPND) virus. The current study was designed to determine if this induction of serum neutralizing antibodies was associated with changes in the specificity of envelope determinants targeted by serum antibodies or caused by changes in the nature of the antibodies targeted to...
Oxford JS, Lambkin R, Sefton A, Daniels R, Elliot A, Brown R, Gill D.The Great Influenza Pandemic of 1918-1919 was a cataclysmic outbreak of infection wherein over 50 million people died worldwide within 18 months. The question of the origin is important because most influenza surveillance at present is focussed on S.E. Asia. Two later pandemic viruses in 1957 and 1968 arose in this region. However we present evidence that early outbreaks of a new disease with rapid onset and spreadability, high mortality in young soldiers in the British base camp at Etaples in Northern France in the winter of 1917 is, at least to date, the most likely focus of origin of the pa...
Miller RL, Webster JK, Mariger SC.The purposes of this study were to identify the source and frequency of agricultural injuries in Utah, and determine an injury rate for common agricultural activities. Previous studies conducted in Utah examined injury rates by utilizing emergency room logs. This study collected data directly from the source, farmers and ranchers in Utah, and included all modes of treatment. A random sample of Utah Farm Bureau members were mailed questionnaires to assess the number of injuries occurring during the past three years, the mode of treatment for the most recent injury, and the percentage of time sp...
Mari G, Iacono E, Merlo B, Castagnetti C.Diagnosis and management of twin pregnancies in the mare are an ongoing challenge in equine reproduction. Early detection of twin and manual crush of one vesicle are the main steps in the management of twins. Few studies were carried out about the use of transvaginal ultrasound-guided aspiration (TUGA) for reduction of twins in the mare. In this study, the efficiency of TUGA for management of twin pregnancies was investigated. Reduction of unicornuate twins between 16 and 25 days of gestation gave a success rate of 70.0% (14 viable foals/20 twin pregnancies); when reduction was performed after...
Chiaradia E, Gaiti A, Terracina L, Avellini L.Physical exercise induces a reduction of immune defences and an imbalance of red-ox status. In this study plasma levels of cysteine and homocysteine (Hcy) were determined in horses before and after submaximal treadmill exercise as well as the effect on horse lymphocyte proliferation. The exercise induced a significant increase in plasma Hcy levels, which remained high both after the 20 min recovery period and after 2 h of rest. Moreover, a reduction of lymphocyte responsiveness to the proliferative stimulus induced by Concanavalin A was observed. The effects of different Hcy concentrations on ...
Ruszczyk A, Cywinska A, Banbura MW.The prevalence of Equine herpesvirus 2 (EHV-2) infections in the horse populations in Poland was investigated. Peripheral blood leukocytes (PBLs) of 139 horses were tested. The animals were divided into four groups: clinically healthy horses, horses suffering from respiratory disorders, mares with a recent abortion and horses with diagnosed ataxia. Thirty-four virus isolates were obtained from leukocytes of the tested animals by cocultivation with equine dermal cells and were identified as EHV-2 by PCR using primers for the gB gene of EHV-2 and/or primers for the sequence located upstream of t...
Potter DA, Foss L, Baumler RE, Held DW.An equine disease now known as mare reproductive loss syndrome (MRLS) struck the Ohio Valley in 2001-2002 causing thousands of foal abortions and enormous economic loss. Evidence that pregnant mares' exposure to Eastern tent caterpillars Malacosoma americanum (F) induces MRLS created an urgent call for control measures suitable for use on horse farms. We surveyed egg mass distribution and monitored emergence in wild cherry trees, and evaluated reduced-risk treatment strategies including foliage sprays, trunk injections, winter egg mass treatments and barrier sprays to intercept larvae entering...
Human movement scienceDecember 14, 2004
Volume 23, Issue 5 663-671 doi: 10.1016/j.humov.2004.10.006
Peham C, Licka T, Schobesberger H, Meschan E.The aim of this study was to show that the motion pattern of a well-ridden horse varies less than the motion pattern of an unridden horse. In order to do so, we recorded the motion of two markers, one attached to the dorsal spinous processus of lumbar vertebra L4, the other to the right fore hoof. In total, we measured 21 horses in trot, ridden and unridden, with a fitting and with a non-fitting saddle. After breaking down the entire time series of the three-dimensional motion of the markers into their respective motion cycles, we computed a measure of motion pattern variability for the motion...
Fuller CJ, Bladon BM, Driver AJ, Barr AR.The objective of this study was to assess the reliability of lameness scoring in horses. One veterinary surgeon examined nineteen lame horses on four occasions. Gait was recorded by camcorder, and scored from 0 to 10 ranging from sound to non-weight bearing lameness. A global score of overall change in lameness during the study was also determined for each horse. To measure intra-assessor reliability of the scoring systems, one veterinary surgeon scored videotapes of the horses' gaits on two occasions. To measure inter-assessor reliability, three veterinary surgeons viewed the videotapes, assi...
van Doorn DA, van der Spek ME, Everts H, Wouterse H, Beynen AC.Literature data show conflicting results on the effect of feeding high calcium (Ca) levels on phosphorus (P) digestibility in ponies. None of the studies reported involved a dose response as to the effect of Ca intake on apparent P digestibility while keeping P intake constant. Thus, the influence of high dietary Ca level on apparent P digestibility was studied in balance trials by feeding six mature ponies three different Ca levels against a constant P intake. The ponies received 148, 316 and 535 mg Ca/kg BW/day with the low, intermediate and high Ca diet. Phosphorus intake was approximately ...
Hausberger M, Bruderer C, Le Scolan N, Pierre JS.The aim of the present study was to broach the question of the relative influence of different genetic and environmental factors on different temperament/personality traits of horses (Equus caballus). The researchers submitted 702 horses to standardized experimental tests and investigated 9 factors, either genetic or environmental. Genetic factors, such as sire or breed, seemed to influence more neophobic reactions, whereas environmental factors, such as the type of work, seemed to play a more dominant role in reactions to social separation or learning abilities. Additive effects were evident,...
Ohta M, Oku K, Mukai K, Akiyama K, Mizuno Y.To assess the clinical usability of propofol-ketamine anesthesia for internal fixation of fractures in racehorses, hemodynamics, blood pH and gases, and vital responses to the continuous intravenous anesthesia in 7 surgical cases were analyzed. The quality of induction with propofol was variable for individual horses. The vital signs reflecting circulation, breath, and anesthetic depth were kept good without any troubles throughout the surgery. Mean time from the end of anesthesia to standing up was prolonged, however recovery from anesthesia was calm and smooth in all cases. Propofol-ketamine...
Kusch S, Oechsner H, Jungbluth T.Experiments on methanogenesis from horse dung were conducted in laboratory-scale batch reactors in order to determine the substrate performance in a solid-phase digestion process, more specifically in terms of potential energy recovery and suitable process technology. Dung from a horse stable with straw bedding was used. The temperature was kept in the mesophilic range. In the percolation process (with process water sprinkled over the stacked biomass) a proportion of 10-20% of solid inoculum (pre-digested horse dung) was found to be suitable. Comparative experiments with both percolation and f...
Lillich JD, Ruggles AJ, Gabel AA, Bramlage LR, Schneider RK.Medical records of 17 horses in which a distal sesamoid bone fracture was diagnosed between 1982 and 1992 were reviewed. There were 8 Standardbreds, 6 Quarter Horses, 2 Thoroughbreds, and 1 Arabian. Mean age was 4.7 years. A forelimb was affected in 15 horses, and a hind limb was affected in 2. All horses were lame, and most were grade III/V lame at the trot. In all horses, the diagnosis was confirmed by means of radiography. Five horses were treated with stall rest alone; 5 underwent neurectomy; 4 were treated with stall rest and corrective shoeing; and 1 was treated with stall rest and exter...
Scocco P, Menghi G, Ceccarelli P, Pedini V.This study was aimed at characterizing the glycoconjugates produced by the horse sublingual gland and, in particular, at discriminating between the sialoderivatives by means of differential oxidation and saponification combined with lectin histochemistry and enzymatic degradation. The results showed a predominance of sialoglycoconjugates with beta-galactose as acceptor sugar in the salivary mucins produced by the sublingual gland. Besides being the most represented terminal residue, sialic acid was also expressed in a great variety of derivatives distinguishable on the basis of acceptor sugars...
Sheahan BJ, Wilkins PA, Lascola KM, Martin V, Po E.Prior studies have shown the prognostic utility of measuring L-lactate in critically ill neonatal foals, both as single (at admission) and serial measurements. Greater prognostic sensitivity and specificity may be achieved by use of the area under the L-lactate versus time curve (LACArea ) over the first 24 hours of hospitalization, which captures both severity and duration of hyperlactatemia. Prior to application of this concept in sick equine neonates, a reference interval for LACArea should be determined. Methods: The concentration of lactate [LAC] was measured in blood obtained via direct ...
Weiss DJ, Trent AM, Johnston G.Prothrombotic changes occurring in the prodromal stages of carbohydrate-induced laminitis were investigated. Hemostatic alterations were evaluated by determining platelet counts, platelet survival, activated partial thromboplastin time, one-stage prothrombin time, and monocyte procoagulant activity. Thrombosis of vessels in the hoof wall was evaluated by contrast arteriography and histologic examination. Of 5 horses, 4 became lame between 28 and 52 hours after carbohydrate administration. Mean platelet count in laminitis-affected horses was lower throughout the prodromal stages of laminitis, c...
Moss GE, Estergreen VL, Becker SR, Grant BD.[1,2,6,7-3H]Progesterone was injected into the uterine artery of umbilical vein of 4 pregnant Ponies to determine whether 5 alpha-pregnane-3,20-dione (DHP), 20 alpha-hydroxy-5 alpha-pregnan-3-one (20 alpha-ol), and 3 beta-hydroxy-5 alpha-pregnan-20-one (3 beta-ol) are produced by the placenta, fetus, or mare during late gestation. Plasma samples were collected from indwelling catheters in the uterine artery and vein and the umbilical artery and vein at frequent intervals until 6 h after isotope injection. The plasma samples were extracted with organic solvents and the respective pregnanes were...
Crawford A, O'Donnell M, Crowe O, Eliashar E, Smith RK.To report the clinical features of horses with fluid-filled masses associated with the digital flexor tendon sheath (DFTS) and outcome after surgery. Methods: Case series. Methods: Horses (n=10) Methods: Medical records of horses with fluid-filled masses associated with the DFTS were reviewed and the clinical features, diagnostic methods, treatment, histopathology, and outcome reported. Results: Masses were unilateral (7 hind limb, 3 front limb) and in 8 horses were associated with lameness. In 6 horses, lameness improved by >50% with intrathecal DTFS anesthesia, whereas 2 were less positiv...
Sayasith K, Bouchard N, Doré M, Sirois J.The objectives of the study were to clone the primary structure of the prostaglandin E2 receptor subtype 2 (PTGER2) cDNA and to characterize its regulation in equine follicles during gonadotropin-induced ovulation. Results from DNA isolation indicated that the equine PTGER2 cDNA encodes a predicted 353-amino acid protein, which is highly similar (76-85%) to known mammalian homologues. The regulation of PTGER2 was studied by semi-quantitative RT-PCR/Southern blot using preparations of theca interna and mural granulosa cells isolated from equine follicles 0-39 hr post-treatment with human chorio...
St George L, Thetford C, Clayton HM, Hobbs SJ.In dressage, horse-rider combinations must demonstrate harmony whilst performing a test of gaits and movements, scored by judge(s) using predetermined criteria. The para dressage governing body is working towards compliance with the International Paralympic Committee's mandate for evidence-based classification, which requires a comprehensive understanding of key performance determinants. This study aimed to explore stakeholder perceptions surrounding the key determinants of, and impact of impairment on, para dressage performance. Semi-structured interviews with 30 para dressage stakeholders (a...
Auer JA, Martens RJ.Valgus deformities were created in 6 pony foals by hemicircumferential transection of the periosteum and periosteal stripping (HCTP and PS) just proximally to the distal physis on the medial side of 1 radius (principal thoracic limb). The opposite thoracic limb served as a control. One month after this surgical procedure was done, the limbs were radiographed and the angle of deviation was determined. All horses developed a valgus deformity of the principal limb. In an effort to correct the acquired valgus deformity, the 2nd surgical procedure was performed--HCTP and PS on the lateral aspect of...
Trim CM, Eaton SA, Parks AH.An 8-year-old Thoroughbred gelding with colic was anesthetized for surgical correction of right dorsal displacement of the ascending colon. Removal of the nasogastric tube at the end of surgery resulted in hemorrhage from the nares and loss of 24 L of blood. Treatment included administration of acetated Ringer's solution, hypertonic saline solution, and dobutamine. A blood transfusion was started after hemorrhage was controlled, and arterial pressure was restored to the prehemorrhage value, but was stopped after infusion of 2.7 L of blood because of a suspected adverse reaction. This case indi...
Dyson SJ.Desmitis of the accessory ligament of the deep digital flexor tendon (ALDDFT) was diagnosed in 27 horses between September 1986 and December 1990. The first observed clinical sign in four horses was localised swelling in the proximal metacarpus. Twenty horses became lame suddenly during a work period and most developed swelling within 24 h of exercise. The injury was confirmed by ultrasonographic examination. Ten of 13 horses with uncomplicated desmitis of the ALDDFT resumed full work, within three to nine months of the onset of clinical signs, without recurrence of clinical signs in the perio...
Lamas LP, Edmonds J, Hodge W, Zamora-Vera L, Burford J, Coomer R, Munroe G.REASONS FOR PERFORMING THIS STUDY: Intra-articular ethanol has been described to promote distal tarsal joint ankylosis. Its use and results in clinical cases affected by osteoarthritis (OA) have not been reported. Objective: To describe and evaluate the results of treatment of distal tarsal joint OA by facilitated ankylosis stimulated by intra-articular ethanol injection. Methods: Twenty-four horses met the inclusion criteria of tarsometatarsal and centrodistal joint OA diagnosed by a positive response to intra-articular analgesia, radiographic evaluation and recurrence of lameness ≤ 4 month...
de Linde Henriksen M, Andersen PH, Mietelka K, Farina L, Thomsen PD, Plummer CE, Mangan BG, Heegaard S, Coleman JK, Toft N, Brooks DE.To investigate histopathologic and immunohistochemical aspects of equine deep stromal abscesses (DSA) with a focus on the histopathologic diagnosis, presumptive etiology, and the immunohistochemical expression of three angiogenesis-related factors: vascular endothelial growth factor-A (VEGF-A), pigment epithelium-derived factor (PEDF), and interleukin-1 receptor antagonist (IL-1ra). Methods: Paraffin-embedded biopsy samples from 51 DSA. The biopsies were collected from full-thickness penetrating keratoplasty or split-thickness lamellar keratoplasty surgeries at the University of Florida Veteri...
Christensen BW, Roberts JF, Pozor MA, Giguere S, Sells SF, Donahue JM.A 4-year-old Thoroughbred mare was evaluated because of placental abnormalities and a retained placental remnant. Results: Microbial culture of the placenta yielded pure growth of Amycolatopsis spp. Histologic examination of the placenta revealed a focally expanding chorionitis with intralesional gram-positive filamentous bacilli and multifocal allantoic adenomatous hyperplasia on the apposing allantoic surface. Results: Treatment with lavage and oxytocin resulted in expulsion of the placental remnant within hours of parturition. The mare did not become pregnant again despite multiple breeding...
Migdał A, Migdał Ł, Oczkowicz M, Okólski A, Chełmońska-Soyta A.The aim of this study was to investigate the molecular mechanisms leading to the identification of pathogens by congenital immune receptors in foals up to 60 days of age. The study was conducted on 16 foal Polish Pony Horses (Polish Konik) divided into two study groups: control ( = 9) and experimental ( = 7). Foals from the experimental group received an intramuscular duplicate injection of 5 mL of Biotropina (Biowet) at 35 and 40 days of age. The RNA isolated from venous blood was used to evaluate the expression of the, , and genes using RT-PCR. The results of the experiment demonstrated a s...
Fehlberg LK, Lattimer JM, Drouillard JS, Douthit TL.Effects of Co on fiber digestibility in horses are largely unknown. Our objective was to evaluate effects of Co chloride on in vitro gas production, VFA production, and dry matter (DM) disappearance (IVDMD) using cecal fluid from 4 cannulated Quarter Horses. Five grams DM of alfalfa or smooth bromegrass hay were provided as substrate with Co added at 0.0, 0.5, 5.0, 25.0, or 50.0 mg/kg substrate DM. Ten milliliters cecal fluid and 140 mL McDougall's buffer were incubated in duplicate, and pH, VFA concentrations, and IVDMD were measured after 48 hours. Gas production, used as an indicator of...
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Schumacher J, Schumacher J, Blanchard T.The endometrial response of mares to repair of third-degree rectovestibular lacerations was evaluated. Endometrial biopsy specimens from 8 mares with third-degree rectovestibular laceration were obtained immediately before surgery and from 9 to 15 days after repair. Presurgical endometrial biopsy specimens were classified as category I for 2 mares; category II, attributable to slight endometritis, for 5 mares; and category III, attributable to moderate-to-severe endometritis, for 1 mare. Within 15 days after rectovestibular repair, all endometrial biopsy specimens were classified as category I...
Thakur BP, Sharma SK, Sharma A, Kumar A.Veterinarians working under remote field conditions are routinely presented with variety of surgical interventions in equines like castrations, management of wound, traumatic and congenital hernias and musculoskeletal disorders thus necessitating the use of general anaesthesia for management of these conditions. The present study was carried out to evaluate and recommend the suitable short term anaesthetic technique for Spiti ponies under field conditions. Seven clinically healthy male Spiti ponies presented for castration were evaluated for short term Total Intravenous Anaesthesia (TIVA) usin...
Andrew SE, Brooks DE, Biros DJ, Denis HM, Cutler TJ, Gelatt KN.OBJECTIVE: To describe and evaluate the use of posterior lamellar keratoplasty as a surgical treatment for deep corneal stromal abscesses in horses. Animals studied Nine horses of various breeds and ages that presented with corneal stromal abscesses located in the posterior one-third of the cornea. Procedure Retrospective medical record study. RESULTS: Nine horses had deep corneal stromal abscesses that were treated with posterior lamellar keratoplasty. Median patient age was 3 years. Six patients were females and three were geldings. Medical therapy alone had been attempted prior to surgery i...
Hedenström UO, Olsson U, Holm AW, Wattle OS.It has not yet been shown that ossification of ungular cartilages (OUC) is a pathological condition. Beside heredity, factors such as sex, age, repeated concussion, local trauma, hoof and body size have been suggested as contributing factors for OUC development. By comparing radiographs of front hooves from cold-blooded trotters with different age we wanted to evaluate when development of OUC in cold-blooded trotters occurs and if and when it stabilizes in relation to age and workload. Diagnosis and grading of OUC were based on radiological field examinations of 649 Swedish and Norwegian cold-...
Fuller CJ, Barr AR, Dieppe PA.An explant system was used to investigate the hypothesis that cartilage from different equine joints might respond differently to challenge with interleukin-1alpha (IL-1alpha). Pairs of normal cartilage samples were taken from the metacarpophalangeal, proximal interphalangeal and distal interphalangeal joints of six horses. One of each pair was stimulated with 10 ng/ml human recombinant IL-1alpha for three days, and the supernatants and remaining cartilage explants were analysed for their total content of glycosaminoglycans. A significantly higher percentage of glycosaminoglycans was released ...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Knight PK, Hamilton NA.To compare handedness of whip use by Australian jockeys in Melbourne (where racing is counterclockwise) and Sydney (where racing is clockwise). Methods: Photographs of finishes of Thoroughbred horse races in Melbourne and Sydney were examined. Where whip use was clearly visible, the venue, the hand in which the whip was held and the names of the jockey and the horse were determined. Comparisons of whip hand use between cities were made using the Chi-squared test. Results: A total of 771 identifications were made, 328 from Melbourne and 443 from Sydney, representing 78 jockeys and 506 horses. R...