Electroencephalography (EEG) in horses is a non-invasive technique used to measure electrical activity in the brain. This method involves placing electrodes on the scalp to detect neural oscillations, providing insights into brain function and neurological health. EEG is utilized in equine research to study brain activity during various states such as sleep, anesthesia, and seizure disorders. It can also aid in understanding behavioral responses and cognitive processes in horses. This page compiles peer-reviewed research studies and scholarly articles that explore the application, methodology, and implications of electroencephalography in equine neurological assessments.
Grint NJ, Johnson CB, Clutton RE, Whay HR, Murrell JC.Donkeys are believed to be less demonstrative of pain than ponies. Research into comparative sensory processing between these species is required to elucidate these behavioural differences. Objective: To compare changes in the electroencephalogram (EEG) recorded during castration between donkeys and ponies. Methods: Prospective clinical study. Methods: Six ponies and 6 donkeys were castrated under halothane anaesthesia after acepromazine premedication and thiopental anaesthetic induction. Markers were inserted into the EEG recording at the time of skin incision (skin) and emasculation (emasc) ...
Wijnberg ID, van der Ree M, van Someren P.Short-duration electroencephalography (EEG) recordings in horses are helpful in diagnosing intracranial disorders. Potentially, long-duration ambulatory EEG (AEEG) recordings in horses will enhance the chance of detecting abnormal brain activity independent of the presence of an insult. Objective: The objective of this study was to test if AEEG recordings in unsedated horses can be acquired and benefit diagnosing abnormal brain activity. Methods: Recordings were taken from 8 adult control horses and 10 patients suspected of intracranial abnormalities. Self-adhesive electrodes and the 'Porti-5'...
Toth B, Aleman M, Brosnan RJ, Dickinson PJ, Conley AJ, Stanley SD, Nogradi N, Williams CD, Madigan JE.To test the hypothesis that application of a rope restraint device would result in behavioral, electroencephalographic, and humoral changes consistent with sleep and analgesia in neonatal foals. Methods: 8 healthy neonatal foals. Methods: Following acclimatization to experimental conditions, each foal underwent a series of assessments before and during or at the end of a period of restraint via application of a restraint device (soft linen rope). Assessments included measurements of heart and respiratory rates, rectal temperature, and circulating β-endorphin and steroid hormone concentrations...
van der Ree M, Wijnberg I.Epilepsy in the horse is diagnosed based on clinical signs, but diagnosing can be difficult if a grand mal is not present. The future prospects of the horse and potentially the safety of the owner depend on an accurate diagnosis. This review presents information on epilepsy and focuses on the diagnostic potential of (Ambulatory) electroencephalography ((A) EEG). An epileptic seizure is a brain disorder, which expresses itself as a recurrent episode of involuntary abnormal behaviour. The aetiology can originate from inside or outside the brain or is idiopathic. Besides those categories, seizure...
Williams DC, Aleman M, Tharp B, Fletcher DJ, Kass PH, Steffey EP, LeCouteur RA, Holliday TA.The administration of certain sedatives has been shown to promote sleep in humans. Related agents induce sleep-like behavior when administered to horses. Interpretation of electroencephalograms (EEGs) obtained from sedated horses should take into account background activity, presence of sleep-related EEG events, and the animal's behavior. Objective: Sedatives induce states of vigilance that are indistinguishable on EEGs from those that occur naturally. Methods: Six healthy horses. Methods: Digital EEG with video was recorded after administration of 1 of 4 sedatives (acepromazine, butorphanol, ...
Finno CJ, Aleman M, Ofri R, Hollingsworth SR, Madigan JE, Winfield L, Bannasch DL.Neuroaxonal dystrophy (NAD) is a disease characterized by the sudden onset of neurologic signs in horses ranging from 4 to 36 months of age. Equine degenerative myeloencephalopathy (EDM), a disease that has been associated with low vitamin E concentrations, is considered a more advanced form of NAD. The objective of this report is to describe the electrophysiological features of NAD/EDM in American Quarter horses (QHs). HORSES: Six NAD/EDM-affected QHs and six unaffected QHs were evaluated by ophthalmic examination and electroretinography. Five of the NAD/EDM-affected QH and five unaffected QH...
Lacombe VA, Mayes M, Mosseri S, Reed SM, Fenner WR, Ou HT.In contrast with reports in man and small animals, a systematic classification of seizures in horses is lacking. Objective: The purpose of this study was to classify seizures based on their aetiology and to characterise epilepsy in 104 horses presented for seizures at the Ohio State University Veterinary Medical Center between 1988 and 2009. Methods: In a retrospective observational study, seizures were classified by aetiology based on history, clinical observations, diagnostic investigations (e.g. electroencephalograms, cerebrospinal fluid and computed tomography imaging of the head) and post...
Finno CJ, Higgins RJ, Aleman M, Ofri R, Hollingsworth SR, Bannasch DL, Reilly CM, Madigan JE.Equine degenerative myeloencephalopathy (EDM) is a neurodegenerative disorder that has been previously associated with low vitamin E concentrations. Objective: To describe the clinical, electrophysiologic, and pathologic features of EDM in a group of related Lusitano horses. Methods: Fifteen Lusitano horses. Methods: Neurologic examinations were conducted, and serum vitamin E concentrations were measured. Three neurologically abnormal horses were further evaluated by ophthalmologic examination, electroretinography, electroencephalography, muscle and nerve biopsies, and post-mortem examination....
Grint NJ, Lorena SE, Johnson CB, Luna SP, Whay HR, Murrell JC.To report the severe metabolic acidosis identified in a group of 11 healthy mules anaesthetized with halothane for castration. Methods: Data generated from a prospective study. Methods: Eleven mules aged 2.5-8 years, weighing 230-315 kg and 11 horses aged 1.5-3.5 years, weighing 315-480 kg. Methods: Animals were anaesthetized for castration as part of an electroencephalographic study. Preanaesthetic medication was acepromazine (0.03 mg kg(-1) ) administered through a preplaced jugular venous catheter. Anaesthesia was induced 30-90 minutes later with intravenous thiopental (10 mg kg(-1) ). ...
Pickles KJ, Gibson TJ, Johnson CB, Walsh V, Murrell JC, Madigan JE.The aim of this study was to develop a technique for recording electrical activity of the equine cerebral cortex following application of a noxious electrical stimulus to the maxillary branch of the trigeminal nerve in order to investigate trigeminal nerve neurophysiology in control and headshaking horses. Triphasic somatosensory evoked potentials (SEPs) were recorded using subcutaneous needle electrodes in four control and four headshaking horses under general anaesthesia. Dural electroencephalography electrodes were used to record SEPs in one further control and one further headshaking horse...
Sogaro-Robinson C, Lacombe VA, Reed SM, Balkrishnan R.To determine neurologic indications associated with abnormal results for computed tomography (CT) imaging of the head of horses affected by neurologic disorders. Methods: Retrospective case series. Methods: 57 horses. Methods: Signalment, history, clinical abnormalities, and clinicopathologic findings were obtained from medical records of horses examined because of neurologic disorders, and precontrast and postcontrast CT images of the head were reviewed. Data were analyzed by use of univariate and multivariate logistic regression. Results: For a horse with abnormal mentation, odds of having a...
Williams DC, Aleman M, Holliday TA, Fletcher DJ, Tharp B, Kass PH, Steffey EP, LeCouteur RA.The influence of sleep on the equine electroencephalogram (EEG) has not been well documented. Objective: The objectives were to develop a noninvasive method of electrode placement for recording the EEG in horses and to establish normal EEG parameters for the various states of vigilance. Findings are compared with previously published reports on equine sleep based on electrocorticography (ECoG). Methods: Five neurologically normal horses. Methods: Overnight EEGs were recorded digitally in association with simultaneous videotaping of the horses' behavior. Data were analyzed by visual inspection,...
Aleman M, Gray LC, Williams DC, Holliday TA, Madigan JE, LeCouteur RA, Magdesian KG.Epilepsy is relatively uncommon in horses compared with other species and limited information is available. Objective: The objectives of the study were to describe the age of onset, clinical signs, clinicopathologic data, electroeticephalographic findings, treatment, and outcome, including long-term prognosis in Arabian foals with idiopathic epilepsy. Methods: Twenty-two foals were included in the study. Methods: Medical records from 1985 to 2005 were reviewed. Results: The age of onset of affected foals ranged from 2 days to 6 months. Seizures were characterized by generalized tonic and cloni...
Kruluc P, Nemec A.Clinically, the use of detomidine and butorphanol is suitable for sedation and deepening of analgosedation. The aim of our study was to establish the influence of detomidine used alone and a butorphanol-detomidine combination on brain activity and to evaluate and compare brain responses (using electroencephalography, EEG) by recording SEF90 (spectral edge frequency 90%), individual brain wave fractions (beta, alpha, theta and delta) and electromyographic (EMG) changes in the left temporal muscle in standing horses. Ten clinically healthy cold-blooded horses were divided into two groups of five...
Murrell JC, White KL, Johnson CB, Taylor PM, Doherty TJ, Waterman-Pearson AE.To record the electroencephalographic changes during castration in ponies anaesthetized with halothane and given intravenous (IV) lidocaine by infusion. The hypothesis tested was that in ponies, IV lidocaine is antinociceptive and would therefore obtund EEG changes during castration. Methods: Ten Welsh mountain ponies referred to the Department of Clinical Veterinary Medicine, Cambridge for castration under general anaesthesia. Methods: Following pre-anaesthetic medication with intramuscular acepromazine (0.02 mg kg(-1)) anaesthesia was induced with IV guaiphenesin (60 mg kg(-1)) and thiopenta...
Haga HA, Dolvik NI.To evaluate Fourier-transformed electroencephalographic (EEG) variables, mean arterial blood pressure (MAP) and pulse rate as nociceptive indicators in isoflurane-anaesthetized horses. Methods: Five standardbred and three Norwegian cold-blooded trotter stallions undergoing castration, aged 2-4 years, mass 378-538 kg. Methods: All horses received intravenous (IV) detomidine (10 microg kg(-1) IV) and butorphanol (0.01 mg kg(-1) IV). Additional detomidine (4 microg kg(-1) IV) was administered in the induction area. Anaesthesia was induced with ketamine (2.5 mg kg(-1) IV) and diazepam (40 microg k...
Murrell JC, Johnson CB, White KL, Taylor PM, Haberham ZL, Waterman-Pearson AE.To identify changes in the amplitude spectrum of the electroencephalogram (EEG) during a standardized surgical model of nociception in horses. Methods: Thirteen entire male horses and ponies referred to Division of Clinical Veterinary Science, Bristol (n = 9) and Department of Clinical Veterinary Medicine (n = 4) for castration. Methods: Following pre-anaesthetic medication with acepromazine, anaesthesia was induced with guaiphenesin and thiopental and maintained with halothane in oxygen. The EEG was recorded continuously using subcutaneous needle electrodes. Additional monitoring comprised EC...
Johnson CB, Bloomfield M, Taylor PM.The electroencephalographic (EEG) effects of a rapid infusion of midazolam and sarmazenil following a bolus of midazolam were investigated in eight Welsh mountain ponies anaesthetized with 0.8% halothane in oxygen. The peak plasma concentration of midazolam was 2.13 +/- 0.34 ng/mL (mean +/- SD) occurring 5 min after the start of the infusion. Sarmazenil concentrations were not measured. The 95% spectral edge frequency of the EEG decreased by a maximum of 39.8 +/- 15.8%, 10 min after the start of the midazolam infusion. No changes were seen in median frequency of the EEG or the second different...
Haga HA, Dolvik NI.To determine whether the bispectral index (BIS) can be used as an indicator of degree of CNS depression in isoflurane-anesthetized horses. Methods: 10 Standardbred and 6 Norwegian cold-blooded trotter stallions admitted for routine castration. Methods: A 2-channel referential electrode configuration was used to record EEG for calculation of BIS by the EEG monitor. The BIS was calculated before (awake) and after (sedated) administration of detomidine (0.01 mg/kg of body weight, IV) and butorphanol (0.01 mg/kg, IV). Anesthesia was induced with ketamine hydrochloride (2.5 mg/kg, IV) and diazepam ...
Lacombe VA, Podell M, Furr M, Reed SM, Oglesbee MJ, Hinchcliff KW, Kohn CW.Electroencephalography (EEG) is a valuable diagnostic test to identify functional disturbances in brain activity. The purpose of this study was to assess the validity of EEG as a diagnostic indicator of intracranial diseases in horses. The validity of EEG was estimated by comparing clinical, clinicopathologic, and histopathologic findings to EEG findings in 20 horses examined for seizures. collapse, or abnormal behavior between 1984 and 1997. A bipolar left-to-right, back-to-front montage and a bipolar circular montage were recorded from sedated (4) and anesthetized (16) horses. Visual and sem...
Johnson CB, Bloomfield M, Taylor PM.To investigate the effects of ketamine on the electroencephalogram (EEG) of the horse. Methods: Prospective experimental study. Methods: Eight Welsh mountain pony geldings weighing between 280 and 330 kg, 5 to 9 years old. Methods: During halothane anesthesia at an end-tidal halothane concentration between 0.75 and 0.85%, the EEG frequency power spectrum and the auditory evoked potential were recorded while an infusion of ketamine was given. Ketamine 200 mg was infused over 5 minutes in 8 ponies. The effects of ketamine on the EEG were recorded continuously during the infusion and for a furthe...
Johnson CB, Taylor PM.We have investigated in eight ponies the effects of three different end-tidal concentrations of halothane, isoflurane and methoxyflurane on median (F50) and 95% spectral edge (F95) frequencies of the EEG and the second differential (DD) of the middle latency auditory evoked potential (MLAEP). The three concentrations of each agent were chosen to represent approximately the minimum alveolar concentration (MAC), 1.25 MAC and 1.5 MAC for each agent. During halothane anaesthesia, F95 decreased progressively as halothane concentration increased, from mean 13.9 (SD 2.6) at 0.8% to 11.9 (1.1) at 1.2%...
Johnson CB, Taylor PM.Opioids have variable effects on the minimum alveolar concentration of inhaled anaesthetics in the horse. During halothane anaesthesia at an end-tidal halothane concentration between 0.75 and 0.85 percent, the electroencephalogram (EEG) frequency power spectrum and the auditory evoked potential were recorded continuously in eight ponies during an infusion of approximately 40 micrograms kg-1 alfentanil over five minutes, and for a further 55 minutes. The spectral edge and median frequency of the EEG and the mid-latency of the auditory evoked potential at the time of maximum change of these vari...
Otto KA, Voight S, Piepenbrock S, Deegen E, Short CE.The effects of noxious surgical stimulation on the electroencephalogram (EEG) in 15 horses anesthetized with isoflurane were evaluated during orthopedic (group 1) and soft tissue (group 2) procedures. The quantitative EEG variables theta/delta ratio (T/D), alpha/delta ratio (A/D), beta/delta ratio (B/D), median power frequency (MED), and 80% spectral edge frequency (SEF 80) recorded during Surgeries at 1.7% end-tidal concentration of isoflurane (ET(iso)) were compared with values from five nonstimulated control horses anesthetized at 1,7% ET(iso). The EEG variables T/D, A/D, MED, and SEF 80 fr...
Miller SM, Short CE, Ekström PM.We compared the anesthetic combination of detomidine, ketamine, and halothane in control horses not undergoing apparently painful procedures with that in horses during arthroscopic surgery. The effectiveness of this regimen in suppressing neurologic response to surgery was, thus, evaluated. In this study, significant differences were not observed in electroencephalographic total amplitude, spectral edge, or beta-to-delta frequency ratio between surgically treated and nonsurgically treated (control) horses. On the basis of its attenuation of encephalographic responses, we conclude that detomidi...
Johnson CB, Young SS, Taylor PM.The electroencephalogram (EEG) has been used in human clinical anaesthesia as an indicator of cortical activity and as an indicator of the depth of anaesthesia. It would be useful if it provided a reliable indication of the depth of anaesthesia of horses. In this study anaesthesia was induced with thiopentone and maintained with halothane in nine ponies. The end tidal halothane concentration (PE-Hal) was monitored and 20 seconds of EEG were recorded at 0.8 per cent, 1.0 per cent and 1.2 per cent halothane, equivalent to the minimum alveolar concentration (MAC), 1.25 MAC and 1.5 MAC. Each 20 se...
Lunn DP, Cuddon PA, Shaftoe S, Archer RM.In an investigation of 2 closely related Miniature Horses with a history of excessive sleepiness, depression and episodes of collapse, a diagnosis of narcolepsy was made on the basis of neurological examination and pharmacological testing. Further investigations included electroencephalographic examination (EEG), and analysis of protein content, cell count and monoamine metabolite concentrations of lumbosacral cerebrospinal fluid (CSF). There were no abnormalities noted in the EEGs, and no consistent changes in CSF neurotransmitter metabolites in the narcoleptic horses when compared with 3 nor...
Ekström PM, Short CE, Geimer TR.This study was done to compare the electroencephalographic (EEG) response evoked by orthopedic surgery in halothane- and isoflurane-anesthetized horses. Eight horses scheduled for bilateral arthroscopic surgery of the stifle were premedicated with detomidine (20 micrograms/kg) intravenously and five minutes later induced to anesthesia with ketamine (2.2 mg/kg) intravenously. Anesthesia was maintained with either halothane or isoflurane. Assignment of inhalation anesthetic was done randomly. The multiple of minimal alveolar concentration (MAC) of halothane required for anesthesia was significan...
Otto K, Short CE.Electroencephalographic (EEG) power spectrum analysis was performed in 18 conscious, adult horses for evaluation as control values for EEG data obtained during anesthesia. Computer-processed total amplitudes for the frequency range 0 to 32 Hz were mainly between 400 and 600 microV, with 80% spectral edge frequency between 16.6 and 32.5 Hz. The highest electrical activity was in the delta band (41.3 +/- 4.4% of total amplitude); there was a less pronounced activity in the beta (34.2 +/- 5.2%), theta (13.6 +/- 1.5%), and alpha (10.0 +/- 1.0%) bands. The applicability of EEG power spectrum analys...
Andrews FM, Fenner WR.Electrodiagnostic aids, electromyography, auditory brainstem response testing, and electroencephalography are extensions of the neurologic examination and provide valuable information about the nervous system. This article discusses the use and interpretation of electrodiagnostic aids in equine neurology as well as the equipment that is employed. It is hoped that with a better understanding of the available electrodiagnostic aids, they will come into greater use.
Aleman M, Davis E, Williams DC, Madigan JE, Smith F, Guedes A.An intravenous (IV) overdose of pentobarbital sodium is the most commonly used method of euthanasia in veterinary medicine. However, this compound is not available in many countries or rural areas resulting in usage of alternative methods such as intrathecal lidocaine administration after IV anesthesia. Its safety and efficacy as a method of euthanasia have not been investigated in the horse. Objective: To investigate changes in mean arterial blood pressure and electrical activity of the cerebral cortex, brainstem, and heart during intrathecal administration of lidocaine. Our hypothesis was th...
de Camp NV, Ladwig-Wiegard M, Geitner CIE, Bergeler J, Thöne-Reineke C.As has been hypothesized more than 20 years ago, data derived from Electroencephalography (EEG) measurements can be used to distinguish between behavioral states associated with animal welfare. In our current study we found a high degree of correlation between the modulation index of phase related amplitude changes in the EEG of horses ( = 6 measurements with three different horses, mare and gelding) and their facial expression, measured by the use of the horse grimace scale. Furthermore, the pattern of phase amplitude coupling (PAC) was significantly different between a rest condition and a s...
Stomp M, d'Ingeo S, Henry S, Lesimple C, Cousillas H, Hausberger M.Assessing chronic pain is a challenge given its subjective dimension. In humans, resting state electroencephalography (EEG) is a promising tool although the results of various studies are contradictory. Spontaneous chronic pain is understudied in animals but could be of the highest interest for a comparative study. Riding horses show a very high prevalence of back disorders thought to be associated with chronic pain. Moreover, horses with known back problems show cognitive alterations, such as a lower attentional engagement. Therefore, we hypothesized that the individual EEG power profiles res...
Sogaro-Robinson C, Lacombe VA, Reed SM, Balkrishnan R.To determine neurologic indications associated with abnormal results for computed tomography (CT) imaging of the head of horses affected by neurologic disorders. Methods: Retrospective case series. Methods: 57 horses. Methods: Signalment, history, clinical abnormalities, and clinicopathologic findings were obtained from medical records of horses examined because of neurologic disorders, and precontrast and postcontrast CT images of the head were reviewed. Data were analyzed by use of univariate and multivariate logistic regression. Results: For a horse with abnormal mentation, odds of having a...
Murillo C, Weng HY, Weil AB, Kreuzer M, Ko JC.This study aimed to investigate the use of electroencephalography (EEG) for detecting brain activity changes perioperatively in anesthetized horses subjected to surgery. Twelve adult horses undergoing various surgeries were evaluated after premedication with xylazine and butorphanol, induction with ketamine, midazolam, and guaifenesin, and maintenance with isoflurane. The frontal EEG electrodes were placed after the horse was intubated and mechanically ventilated. The EEG data were collected continuously from Stage (S)1-transition from induction to isoflurane maintenance, S2-during surgery, S3...
Aleman M, Finno CJ, Weich K, Penedo MCT.The carrier status of lavender foal syndrome (LFS), cerebellar abiotrophy (CA), severe combined immunodeficiency (SCID), and occipitoatlantoaxial malformation (OAAM1) in foals with juvenile idiopathic epilepsy (JIE) is unknown. Objective: To determine the carrier status of LFS, CA, SCID, and OAAM1 in foals with JIE. Methods: Ten foals with JIE. Methods: Archived DNA samples were tested for known genetic mutations causing LFS, CA, SCID, and OAAM1. The inclusion criteria consisted of having been diagnosed with JIE by ruling out other causes of seizures in foals and supported by electroencephalog...
Grint NJ, Johnson CB, Clutton RE, Whay HR, Murrell JC.Donkeys are believed to be less demonstrative of pain than ponies. Research into comparative sensory processing between these species is required to elucidate these behavioural differences. Objective: To compare changes in the electroencephalogram (EEG) recorded during castration between donkeys and ponies. Methods: Prospective clinical study. Methods: Six ponies and 6 donkeys were castrated under halothane anaesthesia after acepromazine premedication and thiopental anaesthetic induction. Markers were inserted into the EEG recording at the time of skin incision (skin) and emasculation (emasc) ...
Johnson CB, Bloomfield M, Taylor PM.To investigate the effects of ketamine on the electroencephalogram (EEG) of the horse. Methods: Prospective experimental study. Methods: Eight Welsh mountain pony geldings weighing between 280 and 330 kg, 5 to 9 years old. Methods: During halothane anesthesia at an end-tidal halothane concentration between 0.75 and 0.85%, the EEG frequency power spectrum and the auditory evoked potential were recorded while an infusion of ketamine was given. Ketamine 200 mg was infused over 5 minutes in 8 ponies. The effects of ketamine on the EEG were recorded continuously during the infusion and for a furthe...
Johnson CB, Taylor PM.Opioids have variable effects on the minimum alveolar concentration of inhaled anaesthetics in the horse. During halothane anaesthesia at an end-tidal halothane concentration between 0.75 and 0.85 percent, the electroencephalogram (EEG) frequency power spectrum and the auditory evoked potential were recorded continuously in eight ponies during an infusion of approximately 40 micrograms kg-1 alfentanil over five minutes, and for a further 55 minutes. The spectral edge and median frequency of the EEG and the mid-latency of the auditory evoked potential at the time of maximum change of these vari...
Lunn DP, Cuddon PA, Shaftoe S, Archer RM.In an investigation of 2 closely related Miniature Horses with a history of excessive sleepiness, depression and episodes of collapse, a diagnosis of narcolepsy was made on the basis of neurological examination and pharmacological testing. Further investigations included electroencephalographic examination (EEG), and analysis of protein content, cell count and monoamine metabolite concentrations of lumbosacral cerebrospinal fluid (CSF). There were no abnormalities noted in the EEGs, and no consistent changes in CSF neurotransmitter metabolites in the narcoleptic horses when compared with 3 nor...
van der Ree M, Wijnberg I.Epilepsy in the horse is diagnosed based on clinical signs, but diagnosing can be difficult if a grand mal is not present. The future prospects of the horse and potentially the safety of the owner depend on an accurate diagnosis. This review presents information on epilepsy and focuses on the diagnostic potential of (Ambulatory) electroencephalography ((A) EEG). An epileptic seizure is a brain disorder, which expresses itself as a recurrent episode of involuntary abnormal behaviour. The aetiology can originate from inside or outside the brain or is idiopathic. Besides those categories, seizure...
Navarrete-Calvo R, Morgaz J, Gómez-Villamandos RJ, Quirós-Carmona S, Domínguez JM, Ruiz-López P, Granados MM.The bispectral index (BIS) has been evaluated as an indicator of central nervous system (CNS) depression in horses during general anaesthesia. The spectral entropy is another electroencephalographic device and it has not been evaluated yet in horses. Objective: To determine if spectral entropy can assess anaesthetic depth during the different phases of anaesthesia, define the value of state and response entropy during surgical plane of anaesthesia and compare them with BIS. Methods: Clinical, prospective, non-blinded observational study. Methods: Thirty-five horses ASA I or II undergoing sched...
Miller SM, Short CE, Ekström PM.We compared the anesthetic combination of detomidine, ketamine, and halothane in control horses not undergoing apparently painful procedures with that in horses during arthroscopic surgery. The effectiveness of this regimen in suppressing neurologic response to surgery was, thus, evaluated. In this study, significant differences were not observed in electroencephalographic total amplitude, spectral edge, or beta-to-delta frequency ratio between surgically treated and nonsurgically treated (control) horses. On the basis of its attenuation of encephalographic responses, we conclude that detomidi...
Johnson CB, Young SS, Taylor PM.The electroencephalogram (EEG) has been used in human clinical anaesthesia as an indicator of cortical activity and as an indicator of the depth of anaesthesia. It would be useful if it provided a reliable indication of the depth of anaesthesia of horses. In this study anaesthesia was induced with thiopentone and maintained with halothane in nine ponies. The end tidal halothane concentration (PE-Hal) was monitored and 20 seconds of EEG were recorded at 0.8 per cent, 1.0 per cent and 1.2 per cent halothane, equivalent to the minimum alveolar concentration (MAC), 1.25 MAC and 1.5 MAC. Each 20 se...
Zanker A, Wöhr AC, Reese S, Erhard M.Veterinary and human medicine are still seeking a conclusive explanation of the function of sleep, including the change in sleep behaviour over the course of an individual's lifetime. In human medicine, sleep disorders and abnormalities in the electroencephalogram are used for prognostic statements, therapeutic means and diagnoses. To facilitate such use in foal medicine, we monitored 10 foals polysomnographically for 48 h. Via 10 attached cup electrodes, brain waves were recorded by electroencephalography, eye movements by electrooculography and muscle activity by electromyography. Wireless ...
Pickles KJ, Gibson TJ, Johnson CB, Walsh V, Murrell JC, Madigan JE.The aim of this study was to develop a technique for recording electrical activity of the equine cerebral cortex following application of a noxious electrical stimulus to the maxillary branch of the trigeminal nerve in order to investigate trigeminal nerve neurophysiology in control and headshaking horses. Triphasic somatosensory evoked potentials (SEPs) were recorded using subcutaneous needle electrodes in four control and four headshaking horses under general anaesthesia. Dural electroencephalography electrodes were used to record SEPs in one further control and one further headshaking horse...
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
Johnson CB, Bloomfield M, Taylor PM.To identify and characterize the effects of guaiphenesin (GGE) on the electroencephalogram during halothane anaesthesia. Methods: Prospective controlled study. Methods: Eight healthy Welsh mountain pony geldings between 5 and 9 years old and weighing between 270 and 330 kg (mean 301 kg). Methods: Anaesthesia was induced with thiopentone and maintained using halothane in oxygen. End tidal halothane was maintained above 0.75 and below 0.85%. The EEG was recorded continuously and a binaural broad band click stimulus was provided throughout the experiment at 6.1224 Hz. An infusion of 1500 mg GGE w...
Otto KA, Voight S, Piepenbrock S, Deegen E, Short CE.The effects of noxious surgical stimulation on the electroencephalogram (EEG) in 15 horses anesthetized with isoflurane were evaluated during orthopedic (group 1) and soft tissue (group 2) procedures. The quantitative EEG variables theta/delta ratio (T/D), alpha/delta ratio (A/D), beta/delta ratio (B/D), median power frequency (MED), and 80% spectral edge frequency (SEF 80) recorded during Surgeries at 1.7% end-tidal concentration of isoflurane (ET(iso)) were compared with values from five nonstimulated control horses anesthetized at 1,7% ET(iso). The EEG variables T/D, A/D, MED, and SEF 80 fr...
Johnson CB, Bloomfield M, Taylor PM.To characterise the effects of thiopentone on the equine electroencephalogram during halothane anaesthesia. Methods: Prospective controlled study. Methods: Eight healthy Welsh mountain pony geldings between 5 and 9 years old and weighing between 270 and 330 kg (mean 301 kg). Methods: Anaesthesia was induced with thiopentone and maintained using halothane in oxygen. End tidal halothane was maintained above 0.75 and below 0.85%. EEG was recorded continuously and a binaural broad band click stimulus was provided throughout the experiment at 6.1224 Hz. An infusion of 500 mg thiopentone was given o...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Finno CJ, Aleman M, Ofri R, Hollingsworth SR, Madigan JE, Winfield L, Bannasch DL.Neuroaxonal dystrophy (NAD) is a disease characterized by the sudden onset of neurologic signs in horses ranging from 4 to 36 months of age. Equine degenerative myeloencephalopathy (EDM), a disease that has been associated with low vitamin E concentrations, is considered a more advanced form of NAD. The objective of this report is to describe the electrophysiological features of NAD/EDM in American Quarter horses (QHs). HORSES: Six NAD/EDM-affected QHs and six unaffected QHs were evaluated by ophthalmic examination and electroretinography. Five of the NAD/EDM-affected QH and five unaffected QH...
Johnson CB, Bloomfield M, Taylor PM.The electroencephalographic (EEG) effects of a rapid infusion of midazolam and sarmazenil following a bolus of midazolam were investigated in eight Welsh mountain ponies anaesthetized with 0.8% halothane in oxygen. The peak plasma concentration of midazolam was 2.13 +/- 0.34 ng/mL (mean +/- SD) occurring 5 min after the start of the infusion. Sarmazenil concentrations were not measured. The 95% spectral edge frequency of the EEG decreased by a maximum of 39.8 +/- 15.8%, 10 min after the start of the midazolam infusion. No changes were seen in median frequency of the EEG or the second different...
Andrews FM, Fenner WR.Electrodiagnostic aids, electromyography, auditory brainstem response testing, and electroencephalography are extensions of the neurologic examination and provide valuable information about the nervous system. This article discusses the use and interpretation of electrodiagnostic aids in equine neurology as well as the equipment that is employed. It is hoped that with a better understanding of the available electrodiagnostic aids, they will come into greater use.
Vinardell T, Elestwani S, Jamieson C, Karim E, Robin M, Glynn S, Benini R, Aleman M.A standardized protocol for electroencephalography (EEG) under standing sedation for the investigation of epilepsy in foals is needed. Objective: To evaluate a modified standardized EEG protocol under standing sedation using sublingual detomidine hydrochloride in Egyptian Arabian foals. Methods: Nineteen foals (controls, 9; juvenile idiopathic epilepsy [JIE], 10). Methods: Descriptive clinical study. Foals were classified as controls or epileptic based on history or witnessed seizures and neurological examination. Foals were sedated using sublingual detomidine hydrochloride at a dosage of 0.08...
Lacombe VA.Seizures are a diverse and very common set of chronic neurologic disorders in humans and dogs but are less common in horses. Seizures refer to a specific clinical event (described as sudden and severe) regardless of the etiology, which includes both intracranial and extracranial causes. Therefore, after briefly reviewing some definitions, this article aims to describe the use of a standardized classification, which could facilitate a logical approach for the clinician to establish a diagnosis, as well as to use a consistent mode of communication. For instance, seizures can be classified by typ...