Analyze Diet

Topic:Neurological Diseases

Neurological diseases in horses encompass a range of disorders affecting the central and peripheral nervous systems. These conditions can arise from various etiologies, including infectious agents, genetic predispositions, trauma, or metabolic imbalances. Common neurological diseases in horses include equine protozoal myeloencephalitis (EPM), equine herpesvirus myeloencephalopathy (EHM), and cervical vertebral stenotic myelopathy (CVSM), also known as wobbler syndrome. Clinical signs associated with these diseases may include ataxia, weakness, altered gait, and changes in behavior or mental status. Diagnosis typically involves a combination of clinical evaluation, imaging techniques, and laboratory testing. This page compiles peer-reviewed research studies and scholarly articles that investigate the pathophysiology, diagnostic approaches, and treatment options for neurological diseases in equine populations.
Retrospective evaluation of the association between hyponatremia and neurological dysfunction in hospitalized foals (2012-2016): 109 cases.
Journal of veterinary emergency and critical care (San Antonio, Tex. : 2001)    December 17, 2019   Volume 30, Issue 1 66-73 doi: 10.1111/vec.12906
Dunkel B, Dodson F, Chang YM, Slovis NM.Hyponatremia and rapid correction of hyponatremia can lead to neurological abnormalities. The objective of the study was to determine whether plasma sodium concentrations (Na ) and speed of correction of hyponatremia are significantly associated with neurological abnormalities in foals. Methods: Retrospective cohort study 2012 to 2016. Methods: Equine hospital. Methods: One hundred and nine foals <6 months old with hyponatremia (Na concentration ≤125 mmol/L). Methods: Case records were reviewed for any foal with hyponatremia. Clinicopathological findings, presence or absence of neurologi...
Serological evidence of arboviruses and coccidia infecting horses in the Amazonian region of Brazil.
PloS one    December 12, 2019   Volume 14, Issue 12 e0225895 doi: 10.1371/journal.pone.0225895
Gomes FA, Jansen AM, Machado RZ, Jesus Pena HF, Fumagalli MJ, Silva A, Alves BF, Roque ALR, Moraes Figueiredo LT.Arboviruses and protozoans can cause neurologic disorders in horses. In Brazilian Amazon, several horses presenting signs compatible with disorders caused by these infectious agents have been observed. To contribute to the knowledge of this epidemiological picture, we sought to construct a serological diagnostic panel for neurotrophic infectious agents in local horses. A total of 213 blood samples from horses were collected from 29 farms in three municipalities. Samples were evaluated and considered positive when they met the following criteria: titers ≥ 1:80 with the indirect fluorescent an...
Efficacy of FDA-Approved Anti-Inflammatory Drugs Against Venezuelan Equine Encephalitis Virus Infection.
Viruses    December 12, 2019   Volume 11, Issue 12 1151 doi: 10.3390/v11121151
Risner K, Ahmed A, Bakovic A, Kortchak S, Bhalla N, Narayanan A.Venezuelan equine encephalitis virus (VEEV) is a category B select agent pathogen that can be aerosolized. Infections in murine models and humans can advance to an encephalitic phenotype which may result in long-term neurological complications or death. No specific FDA-approved treatments or vaccines are available for the treatment or prevention of VEEV infection. Neurotropic viral infections have two damaging components: neuronal death caused by viral replication, and damage from the subsequent inflammatory response. Reducing the level of inflammation may lessen neurological tissue damage tha...
Fungal and chemical diversity in hay and wrapped haylage for equine feed.
Mycotoxin research    November 27, 2019   Volume 36, Issue 2 159-172 doi: 10.1007/s12550-019-00377-5
Andersen B, Phippen C, Frisvad JC, Emery S, Eustace RA.The presence of fungi and mycotoxins in silage (fermented maize) for cattle and other ruminants have been studied extensively compared to wrapped haylage (fermented grass) for horses and other monogastric animals. The purpose of this work was to examine the fungal diversity of wrapped haylage and conventional hay and to analyse the forage sample for fungal metabolites. Faeces samples were also analysed to study the fate of fungi and metabolites. Fungal diversity of the samples was determined by direct plating on DG18, V8 and MEA and chemical analyses were done using LC-MS/MS. The results show ...
Species-specific consequences of an E40K missense mutation in superoxide dismutase 1 (SOD1).
FASEB journal : official publication of the Federation of American Societies for Experimental Biology    November 25, 2019   Volume 34, Issue 1 458-473 doi: 10.1096/fj.201901455R
Draper ACE, Wilson Z, Maile C, Faccenda D, Campanella M, Piercy RJ.A glutamic acid to lysine (E40K) residue substitution in superoxide dismutase 1 (SOD1) is associated with canine degenerative myelopathy: the only naturally occurring large animal model of amyotrophic lateral sclerosis (ALS). The E40 residue is highly conserved across mammals, except the horse, which naturally carries the (dog mutant) K40 residue. Here we hypothesized that in vitro expression of mutant dog SOD1 would recapitulate features of human ALS (ie, SOD1 protein aggregation, reduced cell viability, perturbations in mitochondrial morphology and membrane potential, reduced ATP production,...
Equine herpesvirus-1 genotype did not significantly affect clinical signs and disease outcome in 65 horses diagnosed with equine herpesvirus-1 myeloencephalopathy.
Veterinary journal (London, England : 1997)    November 13, 2019   Volume 255 105407 doi: 10.1016/j.tvjl.2019.105407
Pusterla N, Hatch K, Crossley B, Wademan C, Barnum S, Flynn K.The objective of this study was to determine if the genotype of equine herpesvirus-1 (EHV-1) impacted clinical disease and outcome of horses with laboratory confirmed equine herpesvirus myeloencephalopathy (EHM). Medical records from 65 horses diagnosed with EHM from 2011 to 2019 were reviewed for signalment, presence and severity of clinical signs (lethargy, fever, ataxia, urinary incontinence) and outcome. Horses were further grouped based on the EHV-1 genotype into neuropathic (D) or non-neuropathic (N) EHV-1 infection. Between the two EHV-1 genotype groups, age and sex distributions were s...
Cauda equina syndrome in an ovarian malignant-mixed müllerian tumor with leptomeningeal spread.
Clinical case reports    October 22, 2019   Volume 7, Issue 12 2341-2345 doi: 10.1002/ccr3.2472
Bernstock JD, Ostby S, Fox B, Sotoudeh H, Janssen A, Kang YJ, Chen J, Prattipati V, Elsayed G, Chagoya G, Yamashita D, Friedman GK, Nabors B, Huh WK....Leptomeningeal metastasis is extremely rare in patients with ovarian cancer, but should be considered in patients presenting with neurologic deficits such as cauda equine syndrome. Given its poor prognosis and lack of data currently on management, additional studies are needed to optimize treatment regimens and improve outcomes.
Ganglioglioma of the Right Cerebrothalamus in a 7-Year-Old Quarter Horse Cross Gelding.
Frontiers in veterinary science    October 22, 2019   Volume 6 356 doi: 10.3389/fvets.2019.00356
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Viruses in Horses with Neurologic and Respiratory Diseases.
Viruses    October 14, 2019   Volume 11, Issue 10 942 doi: 10.3390/v11100942
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Assessing pathological changes within the nucleus ambiguus of horses with recurrent laryngeal neuropathy: An extreme, length-dependent axonopathy.
Muscle & nerve    October 9, 2019   Volume 60, Issue 6 762-768 doi: 10.1002/mus.26699
Draper ACE, Cahalan SD, Goodwin D, Perkins J, Piercy RJ.Equine recurrent laryngeal neuropathy (RLN) is a naturally occurring model of length-dependent axonopathy characterized by asymmetrical degeneration of recurrent laryngeal nerve axons (RLn). Distal RLn degeneration is marked, but it is unclear whether degeneration extends to include cell bodies (consistent with a neuronopathy). With examiners blinded to RLN severity, brainstem location, and side, we examined correlations between RLN severity (assessed using left distal RLn myelinated axon count) and histopathological features (including chromatolysis and glial responses) in the nucleus ambiguu...
Molecular Surveillance of EHV-1 Strains Circulating in France during and after the Major 2009 Outbreak in Normandy Involving Respiratory Infection, Neurological Disorder, and Abortion.
Viruses    October 4, 2019   Volume 11, Issue 10 916 doi: 10.3390/v11100916
Sutton G, Garvey M, Cullinane A, Jourdan M, Fortier C, Moreau P, Foursin M, Gryspeerdt A, Maisonnier V, Marcillaud-Pitel C, Legrand L, Paillot R....Equine herpesvirus 1 (EHV-1) is an Alphaherpesvirus infecting not only horses but also other equid and non-equid mammals. It can cause respiratory distress, stillbirth and neonatal death, abortion, and neurological disease. The different forms of disease induced by EHV-1 infection can have dramatic consequences on the equine industry, and thus the virus represents a great challenge for the equine and scientific community. This report describes the progress of a major EHV-1 outbreak that took place in Normandy in 2009, during which the three forms of disease were observed. A collection of EHV-1...
Equine Stereotaxtic Population Average Brain Atlas With Neuroanatomic Correlation.
Frontiers in neuroanatomy    October 3, 2019   Volume 13 89 doi: 10.3389/fnana.2019.00089
Johnson PJ, Janvier V, Luh WM, FitzMaurice M, Southard T, Barry EF.There is growing interest in the horse for behavioral, neuroanatomic and neuroscientific research due to its large and complex brain, cognitive abilities and long lifespan making it neurologically interesting and a potential large animal model for several neuropsychological diseases. Magnetic resonance imaging (MRI) is a powerful neuroscientific research tool that can be performed , with adapted equine facilities, or in the research setting. The brain atlas is a fundamental resource for neuroimaging research, and have been created for a multitude animal models, however, none currently exist f...
Transient pelvic limb neuropathy following proximal metatarsal and tarsal magnetic resonance imaging in seven horses.
Equine veterinary journal    October 1, 2019   Volume 52, Issue 3 359-363 doi: 10.1111/evj.13181
Moreno KL, Scallan EM, Friedeck WO, Simon BT.Pelvic limb neuropathy is a rare post-anaesthetic complication. In the authors' experiences, the incidence of post-anaesthesia neuropathy is increased following MRI of the proximal metatarsus and tarsal regions when compared with previously reported incidences of post-anaesthetic neuropathy. Objective: This study reports the incidence, diagnosis, treatment and outcome of seven horses with post-anaesthesia neuropathy following proximal metatarsal and tarsal MRI. Methods: Retrospective case series. Methods: Case record review of horses receiving general anaesthesia for MRI between 1 January 2012...
Delayed onset vagus nerve paralysis after occipital condyle fracture in a horse.
Journal of veterinary internal medicine    September 26, 2019   Volume 33, Issue 6 2780-2785 doi: 10.1111/jvim.15581
Martin-Giménez T, Cruz AM, Barragán A, Montero E, Sanchez PG, Caballero G, Corradini I.Occipital condylar fractures (OCFs) causing delayed onset lower cranial nerve paralysis (LCNPs) are rare. We present a 7-year-old Friesian horse with delayed onset dysphagia caused by vagus nerve (CNX) paralysis and suspicion of glossopharyngeal nerve (CNIX) paralysis developed several days after a minor head injury. Endoscopic examination revealed right laryngeal hemiplegia and intermittent dorsal displacement of the soft palate. An area of submucosal hemorrhage and bulging was appreciated over the dorsal aspect of the medial compartment of the right guttural pouch. Radiological examination o...
Determination of magnetic motor evoked potential latency time cutoff values for detection of spinal cord dysfunction in horses.
Journal of veterinary internal medicine    September 6, 2019   Volume 33, Issue 5 2312-2318 doi: 10.1111/jvim.15576
Rijckaert J, Pardon B, Saey V, Raes E, Van Ham L, Ducatelle R, van Loon G, Deprez P.Transcranial magnetic stimulation (TMS) and recording of magnetic motor evoked potentials (MMEP) can detect neurological dysfunction in horses but cutoff values based on confirmed spinal cord dysfunction are lacking. Objective: To determine latency time cutoff for neurological dysfunction. Methods: Five control horses and 17 horses with proprioceptive ataxia. Methods: Case-control study with receiver operating characteristic curve analysis, based on diagnostic imaging, TMS, and histopathological findings. Horses were included if all 3 examinations were performed. Results: Diagnostic imaging an...
Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.
Genes    September 5, 2019   Volume 10, Issue 9 doi: 10.3390/genes10090681
Marquardt SA, Wilcox CV, Burns EN, Peterson JA, Finno CJ.Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nuc...
Plasma concentrations of steroid precursors, steroids, neuroactive steroids, and neurosteroids in healthy neonatal foals from birth to 7 days of age.
Journal of veterinary internal medicine    September 5, 2019   Volume 33, Issue 5 2286-2293 doi: 10.1111/jvim.15618
Aleman M, McCue PM, Chigerwe M, Madigan JE.Transient hypothalamic-pituitary-adrenal axis dysfunction occurs in critically ill foals with sepsis and neonatal maladjustment syndrome (NMS). Cortisol is the most commonly measured steroid. However, a complex interaction of various steroid compounds might play a role in pathophysiology of this disorder. Objective: To identify steroid compounds present at high concentrations at birth that rapidly and steadily decrease within the first 7 days of life in healthy foals and that might be supportive diagnosis of NMS and other neonatal disorders. Methods: Ten healthy neonatal Quarter Horse foals ...
A novel PCR protocol for detection and differentiation of neuropathogenic and non-neuropathogenic equid alphaherpesvirus 1. Lechmann J, Schoster A, Ernstberger M, Fouché N, Fraefel C, Bachofen C.Equid alphaherpesvirus 1 (EHV-1) infections can have a major impact on the horse industry and equine welfare by causing abortion or respiratory or neurologic disease. A single nucleotide polymorphism (A→G) in open reading frame (ORF) 30, encoding the catalytic subunit of the DNA polymerase, has been shown to be a strong predictive marker for neuropathogenicity. Given that a previously established real-time PCR (rtPCR) protocol yielded unsatisfactory results concerning determination of the EHV-1 genotype, we developed and evaluated a new conventional PCR protocol enabling identification of th...
State-of-the-Art Diagnostic Methods to Diagnose Equine Spinal Disorders, With Special Reference to Transcranial Magnetic Stimulation and Transcranial Electrical Stimulation.
Journal of equine veterinary science    September 3, 2019   Volume 81 102790 doi: 10.1016/j.jevs.2019.102790
Journée SL, de Meeus d'Argenteuil C, De Maré L, Boshuizen B, Vanderperren K, Journée LH, de Bruijn M, Bergmann W, Delesalle C.Spinal cord disorders are a common problem in equine medicine. However, finding the site of the lesion is challenging for veterinarians because of a lack of sensitive diagnostic methods that can assess neuronal functional integrity in horses. Although medical imaging is frequently applied to help diagnose corticospinal disorders, this approach does not reveal functional information. For the latter, transcranial magnetic stimulation (TMS) and more recently transcranial electrical stimulation (TES) can be useful. These are brain stimulation techniques that create either magnetic or electrical fi...
Ceratohyoidectomy in standing sedated horses.
Veterinary surgery : VS    August 30, 2019   Volume 48, Issue 8 1391-1398 doi: 10.1111/vsu.13319
Racine J, O'Brien T, Bladon BM, Cruz AM, Stoffel MH, Haenssgen K, Rodgerson DH, Livesey MA, Koch C.To investigate the feasibility and complications associated with ceratohyoidectomy (CHE) in standing sedated horses unaffected (experimental horses) and standing sedated horses affected (clinical cases) with temporohyoid osteoarthropathy (THO). Methods: Case series. Methods: Six experimental horses and four clinical cases. Methods: Standing CHE was performed in six experimental horses euthanized 30 minutes (n = 3) and 7 days (n = 3) postoperatively. The four clinical cases were presented because of central facial nerve paralysis (n = 3), vestibular ataxia (n = 3), auricular hemorrhage (n =...
Comparison of the clinical and radiographic appearance of the cervical vertebrae with histological and anatomical findings in an eight-month old warmblood stallion suffering from cervical vertebral stenotic myelopathy (CVSM).
BMC veterinary research    August 15, 2019   Volume 15, Issue 1 296 doi: 10.1186/s12917-019-2047-x
Szklarz M, Lipinska A, Slowikowska M, Niedzwiedz A, Marycz K, Janeczek M.Cervical vertebral stenotic myelopathy (CVSM) remains one of the most important abnormalities of the cervical spine resulting in neurological deficits in horses. The aim of the following study was to compare the results of the clinical and neurological examination, the results of myelography and the post mortem anatomical and histological appearance of the spinal cord and cervical vertebrae in a horse with CVSM. Methods: The following study describes a clinical case of an eight-month-old stallion with ataxia. Plain cervical radiographs indicated narrowing of the spinal canal. Conservative ther...
A study of residual lesions in horses that recovered from clinical signs of chronic equine dysautonomia.
Journal of veterinary internal medicine    July 22, 2019   Volume 33, Issue 5 2302-2311 doi: 10.1111/jvim.15567
Milne EM, Pirie RS, Hahn CN, Del-Pozo J, Drummond D, Moss S, McGorum BC.Equine dysautonomia (ED) causes degeneration and loss of autonomic neurons. Approximately 50% of chronic cases recover, but it is unclear how they survive neuronal loss. Objective: To assess lesions, autonomic neuron numbers, interstitial cells of Cajal (ICC), and neurodegeneration in recovered cases. Methods: Thirteen cases (group ED), euthanized 10.3 ± 5.2 (1-16) years from diagnosis and 6 age-matched controls (group C). Methods: Prospective, case control; routine post mortem examination, neuron counts in peripheral and enteric ganglia and immunohistochemical assessment of neural networ...
Internal fixation of a complete ventral luxation of the dens axis in an American quarter horse yearling.
Veterinary surgery : VS    July 12, 2019   Volume 48, Issue 8 1500-1506 doi: 10.1111/vsu.13283
Schulze N, Ehrle A, Noguera Cender AC, Lischer C.To report surgical treatment of a complete luxation of the atlantoaxial articulation with a 4.5-mm T-locking compression plate (T-LCP) in a horse. Methods: Case report. Methods: A one-year-old American quarter horse filly. Methods: A one-year-old American quarter horse filly presented with a complete luxation of the atlantoaxial articulation. Closed and open reduction of the luxation were attempted under general anesthesia with the aid of a pulley system. Because the manual reduction was unsuccessful, the dens axis was excised, and the atlas and axis were stabilized with a 4.5-mm T-LCP. Fo...
Evaluation of the Structure of Myodural Bridges in an Equine Model of Ehlers-Danlos Syndromes.
Scientific reports    July 10, 2019   Volume 9, Issue 1 9978 doi: 10.1038/s41598-019-46444-w
McElroy A, Rashmir A, Manfredi J, Sledge D, Carr E, Stopa E, Klinge P.Myodural bridges have been described in various species as connective tissue structures "bridging" small cranio-cervical muscles to the dura. Myodural bridges are thought to stabilize the dural sac during head and neck movements and promote cerebrospinal fluid motion; however, their role in neurological diseases has not yet been established. We report ultrasonographic visualization, necropsy, histopathologic and ultrastructural findings of myodural bridges in horses with hereditary equine regional dermal asthenia (HERDA), an equine model of Ehlers-Danlos syndromes. Five HERDA and 5 control hor...
Heterogeneity among traumatic spinal cord injuries at the thoracolumbar junction: helping select patients for clinical trials.
Spinal cord    June 25, 2019   Volume 57, Issue 11 972-978 doi: 10.1038/s41393-019-0317-x
Liu SJ, Wang Q, Tang HH, Bai JZ, Wang FY, Lv Z, Chen SZ, Liu JS, Hong Y, Zhang JW.Retrospective analysis. Methods: China Rehabilitation Research Center, Beijing, China. Objective: A retrospective study that documents the modalities and clarifies the heterogeneity among spinal cord injuries (SCIs) caused by trauma to the thoracolumbar vertebral junction. Methods: X-ray and MRI imaging, neurological records, and the urodynamics results of 190 patients were reviewed and used to categorize different SCI modalities. First, injuries were divided into complete and incomplete injuries using the International Standard for Neurological Classification of Spinal Cord Injury. Next, the ...
Anti-Alzheimer’s multitarget-directed ligands with serotonin 5-HT6 antagonist, butyrylcholinesterase inhibitory, and antioxidant activity.
Archiv der Pharmazie    June 4, 2019   Volume 352, Issue 7 e1900041 doi: 10.1002/ardp.201900041
Marcinkowska M, Bucki A, Panek D, Siwek A, Fajkis N, Bednarski M, Zygmunt M, Godyń J, Del Rio Valdivieso A, Kotańska M, Kołaczkowski M....Serotonin 5-HT receptors, butyrylcholinesterase (BuChE) and oxidative stress are related to the pathophysiology of Alzheimer's disease. Inhibition of BuChE provides symptomatic treatment of the disease and the same effect was demonstrated for 5-HT antagonists in clinical trials. Oxidative stress is regarded as a major and primary factor contributing to the development of Alzheimer's disease; therefore, antioxidant agents may provide a disease-modifying effect. Combining BuChE inhibition, 5-HT antagonism, and antioxidant properties may result in multitarget-directed ligands providing cognitio...
Presumptive tick paralysis in 2 American Miniature horses in the United States.
Journal of veterinary internal medicine    June 3, 2019   Volume 33, Issue 4 1784-1788 doi: 10.1111/jvim.15540
Trumpp KM, Parsley AL, Lewis MJ, Camp JW, Taylor SD.Tick paralysis has not been reported in horses in North America. Results: Two American Miniature horses were examined for progressive weakness and recumbency. Numerous ticks (Dermacentor variabilis) were found on both horses. Horse 1 was recumbent (grade 5/5 gait deficit) on presentation, whereas Horse 2 was standing but ataxic (grade 4/5 gait deficit) and tetraparetic. Both horses had decreased tongue and tail muscle tone, and had normal spinal reflexes. Cerebrospinal fluid cytology was normal. Equine herpesvirus-1 testing was negative. Unassigned: Ticks were removed within 24 hours of pres...
Surgical correction of a meningoencephalocele in a thoroughbred filly.
Veterinary surgery : VS    May 28, 2019   Volume 48, Issue 8 1483-1489 doi: 10.1111/vsu.13240
Buck AM, Hunt RJ.To describe the surgical correction of a closed meningoencephalocele in a thoroughbred filly. Methods: Case report. Methods: One thoroughbred filly, 1.5 months old at the time of surgery. Methods: A meningoencephalocele was identified at birth and diagnosed with radiography and MRI. The abnormal tissue was excised and submitted for histopathology, the dura was closed, and the defect in the skull was corrected with a titanium mesh. Results: Histopathology confirmed the presence of neural parenchyma consisting of neurons and glial cells. The filly remained without neurologic deficits 7 month...
Schwannosis in Three Foals and a Calf.
Veterinary pathology    May 20, 2019   Volume 56, Issue 5 783-788 doi: 10.1177/0300985819846872
Miranda IC, Taylor KR, Castleman W, de Lahunta A, Summers BA, Miller AD.Proliferation of ectopic Schwann cells within the central nervous system (CNS) parenchyma (schwannosis) in early life is most commonly associated with human neurofibromatosis type-2 and has been unrecognized in domestic animals. Three foals and a calf, 5 to 11 weeks old, with progressive neurological signs from birth were studied. Histologically, at multiple levels of the spinal cord, all animals had bilateral plaques of proliferative spindle cells, predominantly affecting the white matter adjacent to dorsal and ventral nerve roots and variably extending into the gray matter. Proliferating cel...
1 8 9 10 11 12 54