Topic:Seizures
Seizures in horses are neurological events characterized by sudden, uncontrolled electrical disturbances in the brain. These episodes can manifest as changes in behavior, motor activity, or consciousness and may vary in duration and severity. The underlying causes of seizures in horses can include genetic predispositions, metabolic disorders, infections, or traumatic brain injuries. Diagnosis often involves a combination of clinical examination, neurological assessment, and diagnostic imaging. This topic encompasses peer-reviewed research studies and scholarly articles that explore the etiology, pathophysiology, diagnostic approaches, and management strategies for seizures in equine patients.
Gabapentin: Clinical Use and Pharmacokinetics in Dogs, Cats, and Horses. Gabapentin is an anticonvulsant drug, which presents an established clinical efficacy in human patients for the management of refractory partial seizures, secondarily generalized tonic-clonic seizures, and for the control of chronic neuropathic pain. Gabapentin was synthesized as a structural analogue of the inhibitory neurotransmitter GABA, with GABA-mimetic effects, able to cross the blood-brain barrier. In veterinary medicine, is extra-label used in combination with other treatments to control seizures when other drugs are no longer effective or become toxic or for neuropathic pain treatmen...
Juvenile idiopathic epilepsy in Arabian horses is not a single-gene disorder. Valued for their temperament, beauty, athletic ability, and exhibition in the show ring, Arabian horses are an important component of the horse industry. Juvenile idiopathic epilepsy (JIE), a seizure disorder, is most often reported in Arabian foals from birth to 6 months of age. Affected foals exhibit tonic-clonic seizures lasting as long as 5 min and risking secondary complications like temporary blindness and disorientation. Some foals outgrow this condition, while others die or suffer lifelong complications if not treated. Previous work suggested a strong genetic component to JIE and propo...
Electroencephalographic evaluation under standing sedation using sublingual detomidine hydrochloride in Egyptian Arabian foals for investigation of epilepsy. A standardized protocol for electroencephalography (EEG) under standing sedation for the investigation of epilepsy in foals is needed. Objective: To evaluate a modified standardized EEG protocol under standing sedation using sublingual detomidine hydrochloride in Egyptian Arabian foals. Methods: Nineteen foals (controls, 9; juvenile idiopathic epilepsy [JIE], 10). Methods: Descriptive clinical study. Foals were classified as controls or epileptic based on history or witnessed seizures and neurological examination. Foals were sedated using sublingual detomidine hydrochloride at a dosage of 0.08...
T-cell-rich, large B-cell lymphoma in the brain of a horse. T-cell-rich, large B-cell lymphoma (TCRLBCL) is the most commonly diagnosed type of lymphoma in horses. Here we describe the clinical signs, neuropathology, immunohistochemistry (IHC), and PCR for antigen receptor rearrangement (PARR) analysis results of a TCRLBCL in the brain of an 8-y-old male Quarter Horse that was euthanized after acute anorexia, tremors, head pressing, falling, blindness, incoordination, and seizures. Autopsy revealed a firm, smooth, pale-yellow mass that expanded both lateral ventricles and the adjacent subcortical white matter. Histologically, the mass consisted of a de...
Traumatic Nervous System Injury. Mechanisms of traumatic nervous system injury to a degree are similar, but differences exist in etiology, pathophysiology, and treatment of brain, spinal cord, and peripheral nerve injury. The most common clinical abnormalities seen in the horse are abnormal level of consciousness, abnormal behavior, seizures, cranial nerve deficits, vestibular disease, tetra- and paraparesis or paraplegia, cauda equina syndrome, specific gait deficits, and muscle atrophy. Treatments are directed toward reducing inflammation and swelling, halting secondary injury, and promoting mechanisms of neuroregeneration ...
Sequence Variant in the TRIM39-RPP21 Gene Readthrough is Shared Across a Cohort of Arabian Foals Diagnosed with Juvenile Idiopathic Epilepsy. Juvenile idiopathic epilepsy (JIE) is a self-limiting neurological disorder with a suspected genetic predisposition affecting young Arabian foals of the Egyptian lineage. The condition is characterized by tonic-clonic seizures with intermittent post-ictal blindness, in which most incidents are sporadic and unrecognized. This study aimed to identify genetic components shared across a local cohort of Arabian foals diagnosed with JIE via a combined whole genome and targeted resequencing approach: Initial whole genome comparisons between a small cohort of nine diagnosed foals (cases) and 27 contro...
Leucoencephalopathy with Pigmented Glia in a Horse with Recurrent Convulsive Seizures. A 7-year-old male Thoroughbred horse exhibited recurrent falls followed by convulsive seizures. The horse was clinically diagnosed with epilepsy and phenobarbital treatment was initiated. However, as seizure control was unsuccessful, the animal was euthanized. At necropsy, yellow-brown linear lesions were found extensively at the U-fibres and cingulate gyrus within the cerebral white matter. Histopathologically, linear demyelination and occasional cavitation were observed. Glial cells with yellow-brown pigment granules, which were autofluorescent, positive to the periodic acid-Schiff reaction ...
The first case of Tyzzer’s disease in a young foal in Italy: a case report. Seizures, coma and death rapidly appeared after admission in a one ‑month‑old foal with a history of lethargy, fever and anorexia. Severe icterus and necrotizing hepatitis were observed at necropsy. Clinical signs, laboratory and postmortem findings were compatible with a suspect of clostridial hepatitis. Tyzzer’s disease was confirmed by the presence of organisms morphologically consistent with Clostridium piliforme in the hepatocytes at the margins of multiple areas of hepatic necrosis. To the authors’ knowledge, this is the first reported case of clostridial hepatitis caused by Clos...
Adverse Effect of Antibiotics Administration on Horse Health: An Overview. Antibiotics-based therapy plays a paramount role in equine medicine because of their potential pharmacokinetics and pharmacodynamics properties. Conventional antibiotics show bacteriostatic and bactericidal properties by interfering bacterial cell wall and protein synthesis as well as inhibiting RNA polymerase, DNase 1, and DNA gyrase. Antibiotics are extensively used not only for the treatment of varied bacterial infections but also the prevention of postoperative and secondary infections. Surprisingly, antibiotics such as sulfonamides or trimethoprim/sulfonamide combinations, benzylpenicilli...
A nonsense variant in Rap Guanine Nucleotide Exchange Factor 5 (RAPGEF5) is associated with equine familial isolated hypoparathyroidism in Thoroughbred foals. Idiopathic hypocalcemia in Thoroughbred (TB) foals causes tetany and seizures and is invariably fatal. Based upon the similarity of this disease with human familial hypoparathyroidism and occurrence only in the TB breed, we conducted a genetic investigation on two affected TB foals. Familial hypoparathyroidism was identified, and pedigree analysis suggested an autosomal recessive (AR) mode of inheritance. We performed whole-genome sequencing of the two foals, their unaffected dams and four unaffected, unrelated TB horses. Both homozygosity mapping and an association analysis were used to prior...
Clinical and Serological Findings of Madariaga and Venezuelan Equine Encephalitis Viral Infections: A Follow-up Study 5 Years After an Outbreak in Panama. Human cases of Madariaga virus (MADV) infection were first detected during an outbreak in 2010 in eastern Panama, where Venezuelan equine encephalitis virus (VEEV) also circulates. Little is known about the long-term consequences of either alphavirus infection. Methods: A follow-up study of the 2010 outbreak was undertaken in 2015. An additional survey was carried out 2 weeks after a separate 2017 alphavirus outbreak in a neighboring population in eastern Panama. Serological studies and statistical analyses were undertaken in both populations. Results: Among the originally alphavirus-seronegat...
Ganglioglioma of the Right Cerebrothalamus in a 7-Year-Old Quarter Horse Cross Gelding. Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses. Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Presumed Neuroglycopenia Caused by Severe Hypoglycemia in Horses. Neuroglycopenia refers to a shortage of glucose in the brain resulting in neuronal dysfunction and death if left untreated. Presumed neuroglycopenia has not been described in horses. Objective: To report neurological signs in horses with presumed neuroglycopenia as the result of severe hypoglycemia. Methods: Ninety horses (hours to 28 years of age) diagnosed with hypoglycemia (blood glucose concentration < 75 mg/dL [< 4.2 mmol/L]). Methods: Retrospective study. Electronic medical records were searched. Signalment, history, complaint, clinical signs, laboratory findings including CSF analysis, ...
Poisoning by Brunfelsia uniflora in sheep and donkeys. Farmers in the State of Piauí in northeastern Brazil reported nervous signs in ruminants and donkeys after ingestion of Brunfelsia uniflora at the start of the rainy season when the plant is flowering. Leaves of the plant, collected at the start or at the end of the rainy season, were administered in single doses of 5-20 g/kg body weight to 8 sheep and 3 donkeys. Two sheep and 1 donkey that ingested 10 g/kg of the plant in November at the start of the rainy season, when the plant was flowering, developed severe convulsions and diarrhea. One sheep was euthanized and autopsied, and no significa...
Pharmacokinetics of the anticonvulsant levetiracetam in neonatal foals. Seizures are a common manifestation of neurological disease in the neonatal foal and are an important cause of morbidity and mortality in this population. Current antiepileptic options are effective, but often have undesirable adverse effects, short duration of action and high cost. Levetiracetam has an ideal safety and pharmacokinetic profile in multiple species, including the adult horse, and may be a safe and cost-effective alternative anticonvulsant in neonatal foals. Due to differences in drug disposition and clearance dosages in neonates, dosing recommendations in other species or adult ...
Investigation of Known Genetic Mutations of Arabian Horses in Egyptian Arabian Foals with Juvenile Idiopathic Epilepsy. The carrier status of lavender foal syndrome (LFS), cerebellar abiotrophy (CA), severe combined immunodeficiency (SCID), and occipitoatlantoaxial malformation (OAAM1) in foals with juvenile idiopathic epilepsy (JIE) is unknown. Objective: To determine the carrier status of LFS, CA, SCID, and OAAM1 in foals with JIE. Methods: Ten foals with JIE. Methods: Archived DNA samples were tested for known genetic mutations causing LFS, CA, SCID, and OAAM1. The inclusion criteria consisted of having been diagnosed with JIE by ruling out other causes of seizures in foals and supported by electroencephalog...
Disposition of levetiracetam in healthy adult horses. Nine horses received 20 mg/kg of intravenous (LEV ); 30 mg/kg of intragastric, crushed immediate release (LEV ); and 30 mg/kg of intragastric, crushed extended release (LEV ) levetiracetam, in a three-way randomized crossover design. Crushed tablets were dissolved in water and administered by nasogastric tube. Serum samples were collected over 48 hr, and levetiracetam concentrations were determined by immunoassay. Mean ± SD peak concentrations for LEV and LEV were 50.72 ± 10.60 and 53.58 ± 15.94 μg/ml, respectively. The y-intercept for IV administration was 64.54 ± 24.99 μg...
Eosinophilic encephalomyelitis in horses caused by protostrongylid parasites. Four thoroughbred horses showing lameness, ataxia, circling, depression, recumbency, and seizures, were examined. The horses had gross, pale- to dark-red manifestations and foci in the central nervous system (CNS). Multifocal to coalescing eosinophilic necrotizing encephalomyelitis was observed histologically in the CNS along with intact or degenerated nematodes. Nematodes had polymyarian-coelomyarian musculature, a smooth thin cuticle, and intestines lined by multinucleated cells with microvilli. These traits suggested the nematodes belonged to the family Protostrongylidae, which includes Par...
Severe hyponatraemia in foals: clinical findings, primary diagnosis and outcome. To evaluate severe hyponatraemia in foals presenting as medical emergencies to an intensive care unit (ICU) in order to determine the prevalence, clinical findings, primary diagnosis and outcome. Methods: Retrospective case study of records from Thoroughbred foals aged less than 3 months presenting to an ICU as medical emergencies in 2002-12; foals with severe hyponatraemia (serum sodium <122 mmol/L) on admission laboratory data were identified. Data retrieved included signalment, clinical findings, laboratory results, primary diagnosis, treatment and outcome. Results: Severe hyponatraemia w...
Factors associated with outcome in 94 hospitalised foals diagnosed with neonatal encephalopathy. Neonatal encephalopathy is the most common neurological abnormality identified in neonatal foals, but its clinical course has been rarely characterised. Objective: To describe factors associated with nonsurvival in a population of foals diagnosed with neonatal encephalopathy. Methods: Retrospective cross-sectional clinical study. Methods: Cases were selected from equine neonatal (≤14 days of age) admissions between 1996 and 2007. Multivariable logistic regression was used to identify clinical parameters, laboratory variables and therapeutic interventions associated with nonsurvival. Results:...
Seizures in horses: diagnosis and classification. Seizures are a diverse and very common set of chronic neurologic disorders in humans and dogs but are less common in horses. Seizures refer to a specific clinical event (described as sudden and severe) regardless of the etiology, which includes both intracranial and extracranial causes. Therefore, after briefly reviewing some definitions, this article aims to describe the use of a standardized classification, which could facilitate a logical approach for the clinician to establish a diagnosis, as well as to use a consistent mode of communication. For instance, seizures can be classified by typ...
Hyponatraemic encephalopathy in azotaemic neonatal foals: four cases. Four neonatal foals were presented, over a 2-year period, (2011-2012) with aimlessly walking, head pressing, 'chewing gum' seizures and ataxia. The neurological lesion was consistent with increased intracranial pressure in all cases. All foals had severe hyponatraemia and azotaemia identified on biochemistry. Hyponatraemia was transient in 3/4 cases, with the foal in the final case requiring long-term sodium supplementation. Three foals survived to hospital discharge; one was euthanased because of anuric renal failure and one of the surviving foals was euthanased with septic osteomyelitis 2 we...
Evaluation of a mouse model for the West Nile virus group for the purpose of determining viral pathotypes. West Nile virus (WNV; family Flaviviridae; genus Flavivirus) group members are an important cause of viral meningoencephalitis in some areas of the world. They exhibit marked variation in pathogenicity, with some viral lineages (such as those from North America) causing high prevalence of severe neurological disease, whilst others (such as Australian Kunjin virus) rarely cause disease. The aim of this study was to characterize WNV disease in a mouse model and to elucidate the pathogenetic features that distinguish disease variation. Tenfold dilutions of five WNV strains (New York 1999, MRM16 a...
Distribution and predictive factors of seizure types in 104 cases. Although many studies have been performed to classify seizures by type in man and small animals, a similar study in horses is lacking. Objective: The aims of this study were as follows: 1) to characterise the distribution of seizure types in 104 horses presented for seizure disorders to a referral veterinary hospital; and 2) to characterise the various types of seizures by identifying associated clinical factors. Methods: Retrospective analysis of clinical records. Methods: Seizures were classified based on seizure type, according to the most recent accepted definitions in both human and small...
Tyzzer’s disease in foals: retrospective studies from 1969 to 2010. Reports of 148 cases of Tyzzer's disease in foals in central Kentucky were analyzed to identify features of the disease and factors associated with it. The records indicate that Tyzzer's disease is a rapidly progressive, highly fatal hepatitis caused by Clostridium piliforme. Common clinical findings are lethargy, fever, anorexia, and icterus. Seizures, coma, and death may rapidly ensue. Laboratory findings are leukopenia, metabolic acidosis, hypoglycemia, and increased activity of hepatic enzymes. Diagnosis is primarily based on clinical signs and postmortem findings but a polymerase chain re...
The applicability of ambulatory electroencephalography (AEEG) in healthy horses and horses with abnormal behaviour or clinical signs of epilepsy. Short-duration electroencephalography (EEG) recordings in horses are helpful in diagnosing intracranial disorders. Potentially, long-duration ambulatory EEG (AEEG) recordings in horses will enhance the chance of detecting abnormal brain activity independent of the presence of an insult. Objective: The objective of this study was to test if AEEG recordings in unsedated horses can be acquired and benefit diagnosing abnormal brain activity. Methods: Recordings were taken from 8 adult control horses and 10 patients suspected of intracranial abnormalities. Self-adhesive electrodes and the 'Porti-5'...
Imaging diagnosis-hypoglycemia associated with cholangiocarcinoma and peritoneal carcinomatosis in a horse. An 8-year-old Thoroughbred mare presented for decreased appetite, ataxia, and weakness. Abdominal ultrasound revealed a large volume of anechoic fluid along with multiple masses involving the spleen, liver, and diaphragm. Pleural fluid was identified via ultrasonography and thoracic radiography. Thoracic radiographs also identified pulmonary interstitial nodules, an undulant dorsal diaphragmatic margin and enlargement of tracheobronchial lymph nodes. Clinical signs of weakness and mild seizures were concurrent with hypoglycemic episodes. The final diagnosis was cholangiocarcinoma with extensiv...
Successful management of severe neuroinvasive eastern equine encephalitis. Eastern Equine Encephalitis (EEE) virus is an arbovirus that mostly causes asymptomatic infection in humans; however, some people can develop a neuroinvasive infection associated with a high mortality. Methods: We present a case of a patient with severe neuroinvasive EEE. Results: A 21-year-old man initially presented with headache, fever, and vomiting and was found to have a neutrophilic pleocytosis in his cerebrospinal fluid. He eventually was diagnosed with EEE, treated with high-dose methylprednisolone and intravenous immunoglobulin. His course in the NeuroIntensive Care Unit was complicat...