Analyze Diet

Topic:Veterinary Care

Veterinary care in horses encompasses the medical and preventive measures taken to maintain and improve the health and well-being of equine patients. It includes a wide range of practices such as routine health examinations, vaccinations, dental care, parasite control, and management of injuries and diseases. Veterinary care also involves diagnostic procedures, surgical interventions, and therapeutic treatments tailored to the specific needs of horses. This page gathers peer-reviewed research studies and scholarly articles that explore various aspects of equine veterinary care, including advancements in diagnostic techniques, treatment protocols, and health management strategies to support the well-being and performance of horses.
The contribution of domestic animals to the transmission of schistosomiasis japonica in the Lindu Subdistrict of the Central Sulawesi Province, Indonesia.
Veterinary world    October 23, 2019   Volume 12, Issue 10 1591-1598 doi: 10.14202/vetworld.2019.1591-1598
Budiono NG, Satrija F, Ridwan Y, Handharyani E, Murtini S.Schistosomiasis is endemic in Indonesia and is found in three remote areas in Central Sulawesi Province. Non-human mammals serve as reservoir hosts, meaning the disease is zoonotic. The previous schistosomiasis studies in animals from the Lindu Subdistrict did not determine which domestic animal species can serve as the primary source of transmission. No animals have been treated in Indonesia to control the disease; therefore, the parasite's life cycle is not blocked entirely. This study aimed to determine the prevalence and identify the risk factors associated with, infection in animals, and...
Can we use LDL instead of egg yolk in BotuCrio® extender to cryopreserve sperm from the Mangalarga Marchador stallion?
Animal reproduction    October 23, 2019   Volume 16, Issue 2 340-347 doi: 10.21451/1984-3143-AR2019-0039
Snoeck PPDN, Pessoa THO, Pereira MGS, Bastos ICL, de Melo MIV.The objective of this study was to compare the BotuCrio extender with the Merk - egg yolk and the INRA 82 modified by the inclusion of acetamide, methyl cellulose and trehalose in substitution of glycerol for freezing equine semen. The semen was diluted after centrifugation to obtain 100 x 10 of sperm/ml in: BotuCrio (control); Merk - egg yolk or INRA 82 modified (Experiment 1). The extended semen was packaged in 0.5 ml straws, cooled and frozen in a freezing machine. The control extender was superior in preserving the motility, VCL, VSL, VAP, LIN, STR and the BCF when compared to the Merk - e...
Factors Associated With Survival and Return to Function Following Synovial Infections in Horses.
Frontiers in veterinary science    October 22, 2019   Volume 6 367 doi: 10.3389/fvets.2019.00367
Crosby DE, Labens R, Hughes KJ, Nielsen S, Hilbert BJ.Synovial infections (SI) are common in horses of all ages and can be associated with high rates of morbidity and mortality. Identifying factors influencing survival and return to function may be useful for management of affected individuals and determination of prognosis. The objectives of this study were to identify factors associated with survival and return to function of horses and foals with SI presented to an equine hospital. This study is a retrospective case series. Data were collected from medical records of all horses with SI that were presented to a single equine hospital between Ap...
Differences in microbiome and virome between cattle and horses in the same farm.
Asian-Australasian journal of animal sciences    October 22, 2019   Volume 33, Issue 6 1042-1055 doi: 10.5713/ajas.19.0267
Park J, Kim EB.The ecosystem of an animal farm is composed of various elements, such as animals, farmers, plants, feed, soil, and microorganisms. A domesticated animal's health is largely connected with the reservoir of bacteria and viruses in animal farms. Although a few studies have focused on exploring the gut microbiome of animals, communities of microbiota and viruses in feedlots have not been thoroughly investigated. Methods: Here, we collected feces and dust samples (4 groups: cattle feces, C_F; horse feces, H_F; cattle dust, C_D; and horse dust, H_D) from cattle and horse farms sharing the same housi...
Morphokinetics of early equine embryo development in vitro using time-lapse imaging, and use in selecting blastocysts for transfer.
Reproduction, fertility, and development    October 22, 2019   Volume 31, Issue 12 1851-1861 doi: 10.1071/RD19225
Lewis N, Schnauffer K, Hinrichs K, Morganti M, Troup S, Argo C.The use of time-lapse imaging (TLI) in the evaluation of morphokinetics associated with invitro developmental competence is well described for human, cattle and pig embryos. It is generally accepted that embryos that complete early cleavage sooner are more likely to form blastocysts and that timing of later events, such as blastocyst formation and expansion, are predictive of implantation potential and euploid status. In the horse, morphokinetics as a predictor of developmental competence has received little attention. In this study we evaluated the morphokinetics of early equine embryo develo...
Investigation of stemness and multipotency of equine adipose-derived mesenchymal stem cells (ASCs) from different fat sources in comparison with lipoma.
Stem cell research & therapy    October 22, 2019   Volume 10, Issue 1 309 doi: 10.1186/s13287-019-1429-0
Arnhold S, Elashry MI, Klymiuk MC, Geburek F.Adipose tissue-derived mesenchymal stem cells (ASCs) offer a promising cell source for therapeutic applications in musculoskeletal disorders. The appropriate selection of ASCs from various fat depots for cell-based therapy is challenging. The present study aims to compare stemness and multipotency of ASCs derived from retroperitoneal (RP), subcutaneous (SC), and lipoma (LP) fat to assess their usefulness for clinical application. Equine ASCs from the three fat tissue sources were isolated and characterized. The cell viability, proliferation, and self-renewal were evaluated using MTT, sulforhod...
Ganglioglioma of the Right Cerebrothalamus in a 7-Year-Old Quarter Horse Cross Gelding.
Frontiers in veterinary science    October 22, 2019   Volume 6 356 doi: 10.3389/fvets.2019.00356
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
Molecular investigation and phylogeny of species of the Anaplasmataceae infecting animals and ticks in Senegal.
Parasites & vectors    October 22, 2019   Volume 12, Issue 1 495 doi: 10.1186/s13071-019-3742-y
Dahmani M, Davoust B, Sambou M, Bassene H, Scandola P, Ameur T, Raoult D, Fenollar F, Mediannikov O.Our study aimed to assess the diversity of the species of Anaplasmataceae in Senegal that infect animals and ticks in three areas: near Keur Momar Sarr (northern region), Dielmo and Diop (Sine Saloum, central region of Senegal), and in Casamance (southern region of Senegal). Methods: A total of 204 ticks and 433 blood samples were collected from ruminants, horses, donkeys and dogs. Ticks were identified morphologically and by molecular characterization targeting the 12S rRNA gene. Molecular characterization of species of Anaplasmataceae infecting Senegalese ticks and animals was conducted usin...
[Ovarian Mixed Tumor in a Mare].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 328 doi: 10.1055/a-1004-9889
Pinna AE, Okada CTC, Ferreira CSC et al. Double ovarian tumor in the mare: case report. Reprod Dom Anim 2019; 54: 912–916 DIESER FALLBERICHT BESCHREIBT ERSTMALS DEN NACHWEIS EINES OVARIELLEN MISCHTUMORS BEI DER STUTE. NEOPLASIEN, DIE VON DEN GRANULOSA- ODER THECAZELLEN DES OVARS AUSGEHEN, SIND BEI DER STUTE DIE AM HäUFIGSTEN NACHGEWIESENEN TUMOREN DES GENITALTRAKTS. ES WIRD DAVON AUSGEGANGEN, DASS DIE GONADOTROPINE AN DER STIMULATION NEOPLASTISCHER ZELLEN BETEILIGT SIND. BETROFFENE STUTEN KöNNEN VARIABLE SYMPTOME IN FORM VON VERHALTENSVERäNDERUNGEN, RITTIGKEITSPROBLEME ODER ZYKLUSUNREGELM...
[Euthanasia in horses – Results of a survey addressing horse owners and veterinarians].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 286-293 doi: 10.1055/a-0975-8643
Gehlen H, Loschelder J, Walther M.Euthanasia represents a procedure with high responsibility for veterinarians in equine practice. The procedure should avoid pain and suffering for the horse and be carried out with the least possible stress for the patient and its owner. The presented study investigated the emotional impact of a horse's euthanasia procedure on the owner in order to enable development of future recommendations in improving the management of this procedure in horses. Methods: Questionnaires concerning euthanasia of a horse for horse owners and veterinarians, respectively were developed and sent by mail or publis...
Results of racetrack examinations of Standardbred horses at race meetings in New South Wales.
Australian veterinary journal    October 21, 2019   Volume 97, Issue 12 509-514 doi: 10.1111/avj.12882
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
[Immunoglobulin concentration in equine colostrum and blood of newborn foals as well as clinically relevant IgG evaluation methods – An overview].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 298-307 doi: 10.1055/a-1005-0004
Sievert M, Krohn J, Wehrend A.Due to the special structure of the equine placenta, foals depend on an adequate intake of high-quality colostrum post natum in order to ensure the development of passive immunity. The quality of the colostrum is determined, among other things, by the IgG content. This may be evaluated in the colostrum by direct and indirect methods (density and refractive index). The density of the colostrum is measured by a colostrometer and should amount to at least 1060 g/l. Refractometry is suitable for assessing the relative density or refractive index. Good equine colostrum has a Brix value of at leas...
Transendoscopic correction of epiglottic entrapment with a silicone-covered laser guide and diode laser in 29 horses.
Veterinary surgery : VS    October 21, 2019   Volume 49, Issue 1 131-137 doi: 10.1111/vsu.13338
Beste KJ, Ortved KF, Rossignol F, Ducharme NG.To describe the use of a silicone-covered laser guide and diode laser for surgical correction of epiglottic entrapment and report postoperative outcomes in horses with epiglottic entrapment. Methods: Retrospective case series. Methods: Thoroughbred and standardbred racehorses (n = 29) with epiglottic entrapment. Methods: A silicone-covered laser guide was placed endoscopically to direct the diode laser cutting action during transection of the entrapping subepiglottic membrane and to act as a physical barrier between the membrane and the epiglottic cartilage. Postoperative complications and tra...
[Cervical Stent for Long-term Treatment of Pyometra in Mares].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 327-328 doi: 10.1055/a-1004-9876
Krohn J, Ennen S, Hospes R et al. Use of a cervical stent for long-term treatment of pyometra in the mare: A report of three cases. Reprod Dom Anim 2019; 55: 1155–1159 DIE PYOMETRA DER STUTE IST EIN CHRONISCHER ENTZüNDUNGSZUSTAND DES ENDOMETRIUMS, DER HäUFIG MIT DER AKKUMULATION GROßER MENGEN AN SEKRET EINHERGEHT. PRäDISPONIERT SIND STUTEN MIT VERäNDERUNGEN DER ZERVIX, DURCH DIE DIE UTERINE CLEARANCE BEEINTRäCHTIGT WIRD. DIE HäUFIG UNSPEZIFISCHEN SYMPTOME UMFASSEN LEISTUNGSMANGEL, KONDITIONSVERLUST, SUBFEBRILE TEMPERATUR ODER KOLIKARTIGE SCHMERZEN. MANCHE TIERE PRäSENTIEREN SICH SYMP...
The Effect of Tree Width on Thoracolumbar and Limb Kinematics, Saddle Pressure Distribution, and Thoracolumbar Dimensions in Sports Horses in Trot and Canter.
Animals : an open access journal from MDPI    October 21, 2019   Volume 9, Issue 10 doi: 10.3390/ani9100842
MacKechnie-Guire R, MacKechnie-Guire E, Fairfax V, Fisher D, Fisher M, Pfau T.This study evaluated the effect of saddle tree width on thoracolumbar and limb kinematics, saddle pressure distribution, and thoracolumbar epaxial musculature dimensions. Correctly fitted saddles were fitted by a Society of Master Saddler Qualified Saddle Fitter in fourteen sports horses (mean ± SD age 12 ± 8.77 years, height 1.65 ± 0.94 m), and were altered to one width fitting wider and narrower. Horses were equipped with skin markers, inertial measurement units, and a pressure mat beneath the saddle. Differences in saddle pressure distribution, as well as limb and thoracolumbosacral kine...
Systemic Administration of Rejuvenated Adipose-Derived Mesenchymal Stem Cells Improves Liver Metabolism in Equine Metabolic Syndrome (EMS)- New Approach in Veterinary Regenerative Medicine.
Stem cell reviews and reports    October 18, 2019   Volume 15, Issue 6 842-850 doi: 10.1007/s12015-019-09913-3
Marycz K, Szłapka-Kosarzewska J, Geburek F, Kornicka-Garbowska K.Equine metabolic syndrome (EMS) is characterized by adiposity, insulin dysregulation and increased risk for laminitis. Increased levels of specific liver enzymes in the peripheral blood are typical findings in horses diagnosed with EMS. Current management of EMS is based on caloric restriction and increased physical activity. However, new potential treatment options are arising such as the transplantation of autologous adipose stem cells (ASC). However, cytophysiological properties of ASC derived from EMS horses are impaired which strongly limits their therapeutic potential. We hypothesized, t...
Characterization of abortion, stillbirth and non-viable foals homozygous for the Warmblood Fragile Foal Syndrome.
Animal reproduction science    October 17, 2019   Volume 211 106202 doi: 10.1016/j.anireprosci.2019.106202
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Ultrasonographic assessment of normal jugular veins in Standardbred horses.
BMC veterinary research    October 16, 2019   Volume 15, Issue 1 343 doi: 10.1186/s12917-019-2104-5
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
Fungal Placentitis Caused by Aspergillus terreus in a Mare: Case Report.
Journal of equine veterinary science    October 15, 2019   Volume 83 102799 doi: 10.1016/j.jevs.2019.102799
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Outcome and complications in horses administered sterile or non-sterile fluids intravenously.
Journal of veterinary internal medicine    October 14, 2019   Volume 33, Issue 6 2739-2745 doi: 10.1111/jvim.15631
Kopper JJ, Bolger ME, Kogan CJ, Schott HC.Obtaining commercial fluids for intravenous administration (IVF) was challenging during a recent shortage. This necessitated use of custom-made non-sterile fluids for intravenous administration (JUGs) in some hospitals. There are no studies comparing outcome of horses treated with JUG versus IVF and limited information is available about adverse effects of JUGs. Objective: To evaluate death, complications, blood pH, and plasma electrolyte concentrations of horses that received JUG versus IVFs. Methods: One hundred eighty-six horses that received IVFs and 37 that received JUGs. Methods: A retro...
A candidate-SNP retrospective cohort study for fracture risk in Japanese Thoroughbred racehorses.
Animal genetics    October 14, 2019   Volume 51, Issue 1 43-50 doi: 10.1111/age.12866
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Thermal, mechanical and electrical stimuli in antinociceptive studies in standing horses: an update.
Veterinary anaesthesia and analgesia    October 13, 2019   Volume 47, Issue 1 15-27 doi: 10.1016/j.vaa.2019.09.003
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Preliminary insight into horse owners’ perceptions of, and attitudes towards, exotic diseases in the United Kingdom.
BMC veterinary research    October 12, 2019   Volume 15, Issue 1 338 doi: 10.1186/s12917-019-2120-5
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =â€...
Multiple excisions of an equine sarcoid and the repercussions.
The Canadian veterinary journal = La revue veterinaire canadienne    October 11, 2019   Volume 60, Issue 10 1115-1117 
Melinyshyn H.A 13-year-old Morgan crossbred mare was presented in May 2018 with a 10-cm mass on the medial aspect of the left hind fetlock. In September and November 2018 and June 2019 the mass was incompletely excised and continued to grow. A diagnosis of spindle cell tumor, consistent with equine sarcoid, was made based on histopathology from the last excision. . Une jument Morgan croisée âgée de 13 ans a été présentée en mai 2018 avec une masse de 10 cm sur l’aspect médial du boulet arrière gauche. En septembre et novembre 2018 ainsi qu’en juin 2019, la masse avait été excisée de manièr...
Sacrococcygeal luxation and complete tail amputation following a tail pull injury in a horse.
The Canadian veterinary journal = La revue veterinaire canadienne    October 11, 2019   Volume 60, Issue 10 1094-1098 
Riddell LP, Yoshimura S, MacKay AV, Wilson DG.A 17-year-old Quarter horse mare was presented because of traumatic luxation of the fifth sacral and first coccygeal vertebrae resulting in loss of sensation, motor function, and perfusion of the tail. The case was complicated by an associated tail head hematoma. Due to the severity of the injury, tail amputation was performed at the level of the luxation. Tail amputations in horses at the sacrococcygeal junction following a suspected tail pull injury are infrequently reported in the literature. . Une jument Quarter horse âgée de 17 ans fut présentée pour cause de luxation traumatique de l...
Culture-independent and dependent evaluation of the equine paranasal sinus microbiota in health and disease.
Equine veterinary journal    October 10, 2019   Volume 52, Issue 3 455-463 doi: 10.1111/evj.13168
Beste KJ, Lawhon SD, Chamoun-Emanuelli AM, Duff AH, Coleman MC, Griffin CE, Hardy J, Whitfield-Cargile CM.Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...
Positive Reinforcement-Based Training for Self-Loading of Meat Horses Reduces Loading Time and Stress-Related Behavior.
Frontiers in veterinary science    October 10, 2019   Volume 6 350 doi: 10.3389/fvets.2019.00350
Dai F, Dalla Costa A, Bonfanti L, Caucci C, Di Martino G, Lucarelli R, Padalino B, Minero M.The present work aimed to evaluate the efficacy of a self-loading training using positive reinforcement on stress-related behaviors shown by meat horses during loading procedures into a truck. Thirty-two meat horses ( = 18; = 14; 6 month-old) were included in the study. All horses had limited interactions with the farmer and were not used to be restrained nor lead by halter. Horses were divided in two groups: Control Group (C; = 14) and Training Group (T; = 18). T horses were trained to self-load: in order to teach the horses to enter into the truck, a targeting training technique throughou...
History, clinical findings and outcome of horses with radiographical signs of equine odontoclastic tooth resorption and hypercementosis.
The Veterinary record    October 10, 2019   Volume 185, Issue 23 730 doi: 10.1136/vr.105253
Rahmani V, Häyrinen L, Kareinen I, Ruohoniemi M.The progression of equine odontoclastic tooth resorption and hypercementosis (EOTRH) has not been completely evaluated, and currently, the only effective treatment is extraction of severely affected teeth. We aim to describe how the disease relates to the history and clinical findings and to report on the outcome in individual horses. This case series comprises data collected from 20 horses (age 14-29 years old) with radiographic findings of EOTRH in their incisor and/or canine teeth. Most horses affected with EOTRH in this study were admitted for dental problems, but some for other complaints...
Risk factors for exertional heat illness in Thoroughbred racehorses in flat races in Japan (2005-2016).
Equine veterinary journal    October 6, 2019   Volume 52, Issue 3 364-368 doi: 10.1111/evj.13179
Takahashi Y, Takahashi T.Exertional heat illness (EHI) is recognised in horses, but few reports have investigated its risk factors. Objective: To identify risk factors for EHI in racehorses participating in flat races in Japan. Methods: Descriptive epidemiology and retrospective unmatched case-control study. Methods: Between 2005 and 2016, veterinary records of horses diagnosed with EHI after flat races were reviewed retrospectively and data of the months from April to September were used for a case-control study. For each case, three control horses were randomly selected from starts between April and September. Race ...