Veterinary care in horses encompasses the medical and preventive measures taken to maintain and improve the health and well-being of equine patients. It includes a wide range of practices such as routine health examinations, vaccinations, dental care, parasite control, and management of injuries and diseases. Veterinary care also involves diagnostic procedures, surgical interventions, and therapeutic treatments tailored to the specific needs of horses. This page gathers peer-reviewed research studies and scholarly articles that explore various aspects of equine veterinary care, including advancements in diagnostic techniques, treatment protocols, and health management strategies to support the well-being and performance of horses.
Crosby DE, Labens R, Hughes KJ, Nielsen S, Hilbert BJ.Synovial infections (SI) are common in horses of all ages and can be associated with high rates of morbidity and mortality. Identifying factors influencing survival and return to function may be useful for management of affected individuals and determination of prognosis. The objectives of this study were to identify factors associated with survival and return to function of horses and foals with SI presented to an equine hospital. This study is a retrospective case series. Data were collected from medical records of all horses with SI that were presented to a single equine hospital between Ap...
Park J, Kim EB.The ecosystem of an animal farm is composed of various elements, such as animals, farmers, plants, feed, soil, and microorganisms. A domesticated animal's health is largely connected with the reservoir of bacteria and viruses in animal farms. Although a few studies have focused on exploring the gut microbiome of animals, communities of microbiota and viruses in feedlots have not been thoroughly investigated. Methods: Here, we collected feces and dust samples (4 groups: cattle feces, C_F; horse feces, H_F; cattle dust, C_D; and horse dust, H_D) from cattle and horse farms sharing the same housi...
Lewis N, Schnauffer K, Hinrichs K, Morganti M, Troup S, Argo C.The use of time-lapse imaging (TLI) in the evaluation of morphokinetics associated with invitro developmental competence is well described for human, cattle and pig embryos. It is generally accepted that embryos that complete early cleavage sooner are more likely to form blastocysts and that timing of later events, such as blastocyst formation and expansion, are predictive of implantation potential and euploid status. In the horse, morphokinetics as a predictor of developmental competence has received little attention. In this study we evaluated the morphokinetics of early equine embryo develo...
Arnhold S, Elashry MI, Klymiuk MC, Geburek F.Adipose tissue-derived mesenchymal stem cells (ASCs) offer a promising cell source for therapeutic applications in musculoskeletal disorders. The appropriate selection of ASCs from various fat depots for cell-based therapy is challenging. The present study aims to compare stemness and multipotency of ASCs derived from retroperitoneal (RP), subcutaneous (SC), and lipoma (LP) fat to assess their usefulness for clinical application. Equine ASCs from the three fat tissue sources were isolated and characterized. The cell viability, proliferation, and self-renewal were evaluated using MTT, sulforhod...
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
Dahmani M, Davoust B, Sambou M, Bassene H, Scandola P, Ameur T, Raoult D, Fenollar F, Mediannikov O.Our study aimed to assess the diversity of the species of Anaplasmataceae in Senegal that infect animals and ticks in three areas: near Keur Momar Sarr (northern region), Dielmo and Diop (Sine Saloum, central region of Senegal), and in Casamance (southern region of Senegal). Methods: A total of 204 ticks and 433 blood samples were collected from ruminants, horses, donkeys and dogs. Ticks were identified morphologically and by molecular characterization targeting the 12S rRNA gene. Molecular characterization of species of Anaplasmataceae infecting Senegalese ticks and animals was conducted usin...
Pinna AE, Okada CTC, Ferreira CSC et al. Double ovarian tumor in the mare: case report. Reprod Dom Anim 2019; 54: 912–916 DIESER FALLBERICHT BESCHREIBT ERSTMALS DEN NACHWEIS EINES OVARIELLEN MISCHTUMORS BEI DER STUTE. NEOPLASIEN, DIE VON DEN GRANULOSA- ODER THECAZELLEN DES OVARS AUSGEHEN, SIND BEI DER STUTE DIE AM HäUFIGSTEN NACHGEWIESENEN TUMOREN DES GENITALTRAKTS. ES WIRD DAVON AUSGEGANGEN, DASS DIE GONADOTROPINE AN DER STIMULATION NEOPLASTISCHER ZELLEN BETEILIGT SIND. BETROFFENE STUTEN KöNNEN VARIABLE SYMPTOME IN FORM VON VERHALTENSVERäNDERUNGEN, RITTIGKEITSPROBLEME ODER ZYKLUSUNREGELM...
Gehlen H, Loschelder J, Walther M.Euthanasia represents a procedure with high responsibility for veterinarians in equine practice. The procedure should avoid pain and suffering for the horse and be carried out with the least possible stress for the patient and its owner. The presented study investigated the emotional impact of a horse's euthanasia procedure on the owner in order to enable development of future recommendations in improving the management of this procedure in horses. Methods: Questionnaires concerning euthanasia of a horse for horse owners and veterinarians, respectively were developed and sent by mail or publis...
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
Sievert M, Krohn J, Wehrend A.Due to the special structure of the equine placenta, foals depend on an adequate intake of high-quality colostrum post natum in order to ensure the development of passive immunity. The quality of the colostrum is determined, among other things, by the IgG content. This may be evaluated in the colostrum by direct and indirect methods (density and refractive index). The density of the colostrum is measured by a colostrometer and should amount to at least 1060 g/l. Refractometry is suitable for assessing the relative density or refractive index. Good equine colostrum has a Brix value of at leas...
Beste KJ, Ortved KF, Rossignol F, Ducharme NG.To describe the use of a silicone-covered laser guide and diode laser for surgical correction of epiglottic entrapment and report postoperative outcomes in horses with epiglottic entrapment. Methods: Retrospective case series. Methods: Thoroughbred and standardbred racehorses (n = 29) with epiglottic entrapment. Methods: A silicone-covered laser guide was placed endoscopically to direct the diode laser cutting action during transection of the entrapping subepiglottic membrane and to act as a physical barrier between the membrane and the epiglottic cartilage. Postoperative complications and tra...
Krohn J, Ennen S, Hospes R et al. Use of a cervical stent for long-term treatment of pyometra in the mare: A report of three cases. Reprod Dom Anim 2019; 55: 1155–1159 DIE PYOMETRA DER STUTE IST EIN CHRONISCHER ENTZüNDUNGSZUSTAND DES ENDOMETRIUMS, DER HäUFIG MIT DER AKKUMULATION GROßER MENGEN AN SEKRET EINHERGEHT. PRäDISPONIERT SIND STUTEN MIT VERäNDERUNGEN DER ZERVIX, DURCH DIE DIE UTERINE CLEARANCE BEEINTRäCHTIGT WIRD. DIE HäUFIG UNSPEZIFISCHEN SYMPTOME UMFASSEN LEISTUNGSMANGEL, KONDITIONSVERLUST, SUBFEBRILE TEMPERATUR ODER KOLIKARTIGE SCHMERZEN. MANCHE TIERE PRäSENTIEREN SICH SYMP...
MacKechnie-Guire R, MacKechnie-Guire E, Fairfax V, Fisher D, Fisher M, Pfau T.This study evaluated the effect of saddle tree width on thoracolumbar and limb kinematics, saddle pressure distribution, and thoracolumbar epaxial musculature dimensions. Correctly fitted saddles were fitted by a Society of Master Saddler Qualified Saddle Fitter in fourteen sports horses (mean ± SD age 12 ± 8.77 years, height 1.65 ± 0.94 m), and were altered to one width fitting wider and narrower. Horses were equipped with skin markers, inertial measurement units, and a pressure mat beneath the saddle. Differences in saddle pressure distribution, as well as limb and thoracolumbosacral kine...
Marycz K, Szłapka-Kosarzewska J, Geburek F, Kornicka-Garbowska K.Equine metabolic syndrome (EMS) is characterized by adiposity, insulin dysregulation and increased risk for laminitis. Increased levels of specific liver enzymes in the peripheral blood are typical findings in horses diagnosed with EMS. Current management of EMS is based on caloric restriction and increased physical activity. However, new potential treatment options are arising such as the transplantation of autologous adipose stem cells (ASC). However, cytophysiological properties of ASC derived from EMS horses are impaired which strongly limits their therapeutic potential. We hypothesized, t...
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Kopper JJ, Bolger ME, Kogan CJ, Schott HC.Obtaining commercial fluids for intravenous administration (IVF) was challenging during a recent shortage. This necessitated use of custom-made non-sterile fluids for intravenous administration (JUGs) in some hospitals. There are no studies comparing outcome of horses treated with JUG versus IVF and limited information is available about adverse effects of JUGs. Objective: To evaluate death, complications, blood pH, and plasma electrolyte concentrations of horses that received JUG versus IVFs. Methods: One hundred eighty-six horses that received IVFs and 37 that received JUGs. Methods: A retro...
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =â€...
Beste KJ, Lawhon SD, Chamoun-Emanuelli AM, Duff AH, Coleman MC, Griffin CE, Hardy J, Whitfield-Cargile CM.Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...
Dai F, Dalla Costa A, Bonfanti L, Caucci C, Di Martino G, Lucarelli R, Padalino B, Minero M.The present work aimed to evaluate the efficacy of a self-loading training using positive reinforcement on stress-related behaviors shown by meat horses during loading procedures into a truck. Thirty-two meat horses ( = 18; = 14; 6 month-old) were included in the study. All horses had limited interactions with the farmer and were not used to be restrained nor lead by halter. Horses were divided in two groups: Control Group (C; = 14) and Training Group (T; = 18). T horses were trained to self-load: in order to teach the horses to enter into the truck, a targeting training technique throughou...
Rahmani V, Häyrinen L, Kareinen I, Ruohoniemi M.The progression of equine odontoclastic tooth resorption and hypercementosis (EOTRH) has not been completely evaluated, and currently, the only effective treatment is extraction of severely affected teeth. We aim to describe how the disease relates to the history and clinical findings and to report on the outcome in individual horses. This case series comprises data collected from 20 horses (age 14-29 years old) with radiographic findings of EOTRH in their incisor and/or canine teeth. Most horses affected with EOTRH in this study were admitted for dental problems, but some for other complaints...
Takahashi Y, Takahashi T.Exertional heat illness (EHI) is recognised in horses, but few reports have investigated its risk factors. Objective: To identify risk factors for EHI in racehorses participating in flat races in Japan. Methods: Descriptive epidemiology and retrospective unmatched case-control study. Methods: Between 2005 and 2016, veterinary records of horses diagnosed with EHI after flat races were reviewed retrospectively and data of the months from April to September were used for a case-control study. For each case, three control horses were randomly selected from starts between April and September. Race ...
Omar H, Hambidge M, Firmanes B, Shabandri AM, Wilsher S.The United Arab Emirates (UAE) presents a unique environment in which to breed horses with a non-physiological breeding season coupled with high temperatures and humidity for much of the year. This study aimed to describe bacterial isolates from the uteri of mares in the UAE and compare them to those reported elsewhere in the world. Bacterial antibiotic resistance was also analyzed to give a starting point for future monitoring. A total of 2,022 swabs taken over five breeding seasons from the endometrium (n = 1,350) or from uterine lavages (n = 672) were submitted for microbiological cultu...
Darghouth MA.Several species of piroplasms of livestock are present in Tunisia; some of them are of high veterinary importance. This paper reviews the species already reported in Tunisia on the basis of clinical observations, parasitological routine diagnostic and serological surveys, as well as those considered as potentially present according to epidemiological argumentations. The genus Theileria includes four species reported in Tunisia: T. annulata, T. buffeli, T. ovis, and T. equi. The ovine malignant theileriosis agent, T. lestoquardi, appears to be absent in Tunisia. Five species belonging to the ge...
Swanberg JE, Clouser JM, Westneat SC, Marsh MW, Reed DB.Animal production is a dangerous industry and increasingly reliant on a Latino workforce. Within animal production, little is known about the risks or the occupational hazards of working on farms involved in various aspects of thoroughbred horse breeding. Extant research suggests that horse workers are at risk of musculoskeletal and respiratory symptoms, kicks, and other injuries. However, limited known research has examined the experiences of the industry's workers, including immigrant workers, despite their prominence and increased vulnerability. Using data collected from thoroughbred farm r...
Sanz MG, Oliveira AF, Page A, Horohov DW.Rhodococcus equi is the most common cause of pneumonia in young foals. A vaccine is not available and the use of R equi-specific hyperimmune plasma (HIP) is common. Despite its widespread use, the efficacy of HIP in preventing disease remains controversial. The objectives of this study were (1) to evaluate the virulence associate protein A (VapA)-specific IgG and IgG subclasses in commercially available R equi HIP and (2) to evaluate serum VapA-specific IgG and IgG subclasses in foals following administration of commercial R equi HIP. Three different lots from four commercial R equi HIP were s...
Pettengill MA, Lam VW, Ollawa I, Marques-da-Silva C, Ojcius DM.Ivermectin is currently approved for treatment of both clinical and veterinary infections by nematodes, including Onchocerca cervicalis in horses and Onchocerca volvulus in humans. However, ivermectin has never been shown to be effective against bacterial pathogens. Here we show that ivermectin also inhibits infection of epithelial cells by the bacterial pathogen, Chlamydia trachomatis, at doses that could be envisioned clinically for sexually-transmitted or ocular infections by Chlamydia.
Reimer JM, Reef VB, Spencer PA.The medical records of 83 horses with pleuropneumonia and/or pulmonary abscessation, in which thoracic sonography was used, were reviewed. The sonograms of these horses were reviewed retrospectively for free gas echoes within pleural or abscess fluid. Anaerobic infection was confirmed in 27 horses, and gas echoes were observed in 21 horses. There was a significant (P less than 0.001) correlation between the observation of gas echoes and anaerobic infection in horses with pleuropneumonia and/or pulmonary abscessation. A foul odor to the breath or pleural fluid was significantly (P less than 0.0...
Redding WR, O'Grady SE.This article addresses nonseptic diseases associated with the hoof complex, namely keratoma, white line disease, canker, and neoplasia. Keratoma is an uncommon cause of lameness, which may be surgically removed. White line disease, a keratolytic process on the solar surface of the hoof, is treated with therapeutic farriery and resection of the hoof wall when appropriate. Equine canker is an infectious process that results in development of a chronic hypertrophy of the horn-producing tissues. Neoplasia involving the equine foot is rare, and melanoma is the most common type of neoplasm reported....
Taylor PM.Information on equine stress responses to anaesthesia and surgery is sparse. Six ponies were anaesthetized for 2 h with halothane and no surgery was performed. Plasma concentrations of glucose, lactate, non-esterified fatty acids, cortisol, insulin, catecholamines and adrenocorticotropic hormone (ACTH) were measured. The results were compared with those obtained in the same group of ponies over the same time period on a different day with the animals conscious. Anaesthesia induced an increase in plasma concentrations of glucose, lactate, cortisol and ACTH and a decrease in plasma concentration...
Pethick FE, Lainson AF, Yaga R, Flockhart A, Smith DG, Donachie W, Cerdeira LT, Silva A, Bol E, Lopes TS, Barbosa MS, Pinto AC, Dos Santos AR....Corynebacterium pseudotuberculosis causes disease in several animal species, although distinct biovars exist that appear to be restricted to specific hosts. In order to facilitate a better understanding of the differences between biovars, we report here the complete genome sequence of the equine pathogen Corynebacterium pseudotuberculosis strain 1/06-A.
Wood JL, Chanter N, Newton JR, Burrell MH, Dugdale D, Windsor HM, Windsor GD, Rosendal S, Townsend HG.Lower respiratory tract disease developed in a group of racehorses in training between two and six years of age. Disease was observed in 22 of 25 horses for which full records were available. Seroconversion to Mycoplasma felis was demonstrated by indirect haemagglutination assay in 19 of 22 paired sera and high titres (> or = 64) were found in convalescent sera from the three remaining horses. Evidence of respiratory viral infection was confined to seroconversions to equine herpesvirus-4 in two of the horses. Tracheal wash samples, taken from four horses with visibly increased tracheal muco...
French KR, Pollitt CC.The key lesion of laminitis is separation at the hoof lamellar dermal-epidermal interface. For this to happen the structural and adhesion proteins of the basement membrane zone must be altered. Which proteins and how damage to them leads to the lamellar separation of laminitis is unknown. Objective: To investigate lamellar hemidesmosome and cytoskeleton damage and basement membrane dysadhesion using light microscopy (LM) and immunofluorescence microscopy (IFM). Methods: Cryostat sections of lamellar tissues from 2 control and 6 Standardbred horses with oligofructose induced laminitis were stud...
Blake CC, Evans PR, Scopes RK.The single peptide chain of 3-phosphoglycerate kinase is folded into two distinct globular units, only one of which seems to be involved in substrate binding.
Maleas G, Mageed M.This retrospective study aimed to evaluate the clinical effect of bone marrow aspirate concentrate (BMAC) and leukocyte rich PRP (LR-PRP) compared to horses undergoing controlled exercise alone in horses with >3 months proximal suspensory desmopathy in hindlimbs (HPSD). Nighty-three horses were divided into three groups according to the treatment: a control (n = 22), LR-PRP (n = 46), and BMAC (n = 25) group. Lameness and ultrasound scores were recorded before treatment (T0) and at 6 months (T1) post-treatment. Records horses considered sound at evaluation and level of performance were addition...
Robinson CS, Timofte D, Singer ER, Rimmington L, Rubio-MartÃnez LM.Bacterial culture and antimicrobial susceptibility testing of septic synovial samples allows instigation of targeted antimicrobial therapy; however, bacterial culture takes more than 24 h and has low sensitivity. This study aimed to identify the most frequently cultured bacteria and their antimicrobial susceptibility profile from septic synovial samples in our referral equine hospital, to allow recommendations regarding appropriate initial antimicrobial therapy prior to culture results. Hospital records for all horses with synovial sepsis and a synovial sample submitted to the microbiology l...
Prichard M, Ducharme NG, Wilkins PA, Erb HN, Butt M.We hypothesized that xanthine oxidase plays a role in the postischemic reperfusion injury in the equine small intestine. Under anesthesia, four horses and two ponies underwent ischemic strangulating obstructions of segments of the proximal jejunum, mid-jejunum and ileum. Prior to vascular occlusion, and at 1 h and 2 h of ischemia, full-thickness intestinal biopsies were collected for histopathological evaluation and for determination of combined xanthine dehydrogenase (XDH) plus xanthine oxidase (XO) activity, and XO activity alone. The level of XO activity was expressed in percentage accordin...
Fesseha H, Mathewos M, Kidanemariam F.Gastrointestinal helminth parasite infection is a major influencing factor against profitability of working equines all over the world. Objective: A study was conducted from October 2016 to May 2017 in and around Hosaena to determine the efficacy of benzimidazole (BZ) and avermectin (AVM) chemical groups against strongyle nematodes in working donkeys. Methods: A total of 230 donkeys from Hosaena, Soro, Anlemo, and Gombora were randomly allocated into 5 groups of 46 donkeys in each group. All groups, except group 1 (control), were treated with ivermectin 1%, ivertong 10%, fenbendazole, and Fena...
Siegers EW, de Ruijter-Villani M, van Doorn DA, Stout TAE, Roelfsema E.Health risks associated with obesity are more likely a factor of the localization of fat excess, rather than of elevated BW per se. The aim of this randomized controlled clinical trial was to determine the effect of a long-term high energy diet on BW, fat accumulation and localization. Eight Shetland pony mares, 3 to 7 years old, were randomly divided into a control and a high energy (HE) diet group fed either maintenance or double maintenance energy requirements (200% net energy (NE)) for two consecutive summers, with a low energy diet in the winter in between. Body condition score (BCS) did ...
Paltrinieri S, Giordano A, Villani M, Manfrin M, Panzani S, Veronesi MC.A field study was undertaken to investigate plasma protein electrophoresis (PPE) and serum amyloid A (SAA) concentrations at 1, 3 and 7 days of age in foals born by oxytocin-induced (group A, n =17) or spontaneous (group B, n =12) parturition. The putative diagnostic role of PPE and SAA in four septicaemic foals was also examined. At birth, beta-gamma-globulins were higher in group B, and then increased in both groups, probably due to colostrum intake. At day 3, no significant differences between the groups were detectable. In both groups, SAA values increased from day 0 to day 3, then decreas...
Zamos DT, Schumacher J, Loy JK.Nasopharyngeal conidiobolomycosis caused by Conidiobolus coronatus was diagnosed in a horse after endoscopic and histopathologic examinations of a biopsy specimen. The fungal lesions in the nasopharynx were substantially reduced in size after intralesional injection of amphotericin B through the biopsy channel of a videoendoscope in combination with i.v. administration of sodium iodide and oral administration of potassium iodide during a 2-month period. Endoscopy performed 15 months after initial examination revealed regression of the granulomatous masses in the nasopharynx and complete disapp...
Studdert MJ, Hartley CA, Dynon K, Sandy JR, Slocombe RF, Charles JA, Milne ME, Clarke AF, El-Hage C.Five of 10 pregnant, lactating mares, each with a foal at foot, developed neurological disease. Three of them became recumbent, developed complications and were euthanased; of the two that survived, one aborted an equine herpesvirus type 1 (EHV-1)-positive fetus 68 days after the first signs were observed in the index case and the other gave birth to a healthy foal on day 283 but remained ataxic and incontinent. The diagnosis of EHV-1 myeloencephalitis was supported by postmortem findings, PCR identification of the virus and by serological tests with an EHV-1-specific ELISA. At the time of the...
Knubben JM, Furst A, Gygax L, Staᆲher M.Studies on the prevalence and predisposing factors of bite and kick injuries in horses have not been reported in a population-based data sample. Objective: To investigate the prevalence of bite and kick injuries in horses and associated risk factors in a representative sample of horses in Switzerland. Methods: A questionnaire on the incidence of disease and injury, which included the frequency of bite and kick injuries and their association with breed, housing, use and feeding regime, was sent to 2559 horse owners randomly selected throughout Switzerland. Results: The data of 2912 horses with ...
Stahlbaum CC, Houpt KA.The role of the Flehmen response in equine behavior was investigated under field and laboratory conditions. In Experiment 1, a field study made of five stallions on pasture with between three and eighteen mares each during the season indicated the following: 1) The Flehmen response was most frequently preceded by nasal, rather than oral, investigation of substances; 2) The stallions' rate of Flehmen varied with the estrous cycles of the mares; 3) The rate of Flehmen response did not show a variation with time of day; and 4) The Flehmen response was most frequently followed by marking behaviors...
Gillis C, Sharkey N, Stover SM, Pool RR, Meagher DM, Willits N.Results of studies in human beings and other species have indicated that aging significantly influences the strength, modulus of elasticity, and energy storage ability of tendon. We wanted to determine the effects of aging on the material and ultrasonographic properties of equine superficial digital flexor (SDF) tendon. Ultrasonographic measurements of left forelimb SDF tendon cross-sectional area and mean echogenicity were made in 23 standing horses ranging in age from 2 to 23 years. All horses had not been in work for a minimum of 6 months prior to the study. After euthanasia, left forelimb ...
De Ridder T, Ruppin M, Wheeless M, Williams S, Reddell P.Tigilanol tiglate is a novel small molecule approved as a veterinary pharmaceutical in Europe for intratumoural treatment of non-metastatic, non-resectable canine mast cell tumors. The drug has a "tumor agnostic" mode of action associated with induction of an acute inflammatory response at the treatment site, immune cell recruitment, and disruption of tumor vasculature. Consequently, tigilanol tiglate has potential in treating a range of tumor types in humans and companion animals. However, it is likely that species-specific dosing and concomitant medication protocols will be required, especia...
Tatz AJ, Segev G, Steinman A, Berlin D, Milgram J, Kelmer G.There is a consensus in the veterinary literature that Parascaris equorum (ascarid) impaction carries a poor prognosis. Hence surgery is often delayed and foals are often subjected to euthanasia after diagnosis of ascarid impaction is established. Our clinical impression was that ascarid impaction carries a better prognosis than previously reported. Objective: Our expectation was that manually evacuating the impaction into the caecum, thus refraining from opening the small intestine, would improve the prognosis for survival of horses with ascarid impaction. The aim of this study was to examine...
Johnson PJ, Slight SH, Ganjam VK, Kreeger JM.The administration of exogenously administered GCs and syndromes associated with GC excess are both attended by increased risk for the development of laminitis in adult horses. However, there exists substantial controversy as to whether excess GCs cause laminitis de novo. If true, the pathogenesis of laminitis arising from the effects of GC excess is probably different from that associated with diseases of the gastrointestinal tract and endotoxemia. Although a satisfactory explanation for the development of laminitis as a consequence of GC action is currently lacking, numerous possible and pla...
Slauson DO, Lewis RM.Glomerulonephritis constitutes an important category of renal diseases in animals and has been recognized with increasing frequency in the last decade. We report here the comparative morphologic aspects of glomerulonephritis as a naturally occurring disease of animals. We briefly review the immunopathogenesis of glomerulonephritis. The morphology of renal lesions occurring in glomerulonephritis in dogs, cats, cattle, sheep, horses and swine has been reviewed with emphasis on the range and specificity of various glomerular lesions and on the comparison of lesions between various species. A dist...
Brooks DE, Andrew SE, Dillavou CL, Ellis G, Kubilis PS.To evaluate in vitro susceptibility to topical antifungal medications, as measured by minimum inhibitory concentration (MIC) and 50% inhibitory concentration (IC50%), of fungal isolates from horses with ulcerative keratomycosis in Florida; to compare results with those of other studies to identify differences in susceptibility patterns among fungi isolated from horses in different geographic regions; and to note indications of fungal resistance to drugs tested in other studies. Methods: Corneal fungal cultures from client-owned horses from Florida with ulcerative keratomycosis (n = 22). Method...