Analyze Diet

Topic:Veterinary Care

Veterinary care in horses encompasses the medical and preventive measures taken to maintain and improve the health and well-being of equine patients. It includes a wide range of practices such as routine health examinations, vaccinations, dental care, parasite control, and management of injuries and diseases. Veterinary care also involves diagnostic procedures, surgical interventions, and therapeutic treatments tailored to the specific needs of horses. This page gathers peer-reviewed research studies and scholarly articles that explore various aspects of equine veterinary care, including advancements in diagnostic techniques, treatment protocols, and health management strategies to support the well-being and performance of horses.
Results of racetrack examinations of Standardbred horses at race meetings in New South Wales.
Australian veterinary journal    October 21, 2019   Volume 97, Issue 12 509-514 doi: 10.1111/avj.12882
Knight PK.This study analysed the race day veterinary reports from harness racing meetings controlled by the New South Wales Greyhound and Harness Racing Regulatory Authority between 1 September 2008 and 30 June 2009. The findings of all prerace and postrace examinations were analysed, and the frequency of observations was recorded. Chi-square testing was used to determine whether the incidence of abnormalities differed between age groups and tracks. A total of 542 meetings were conducted during the period of the study, with veterinary examinations conducted at 395 of these meetings. A total of 520 vete...
[Immunoglobulin concentration in equine colostrum and blood of newborn foals as well as clinically relevant IgG evaluation methods – An overview].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 298-307 doi: 10.1055/a-1005-0004
Sievert M, Krohn J, Wehrend A.Due to the special structure of the equine placenta, foals depend on an adequate intake of high-quality colostrum post natum in order to ensure the development of passive immunity. The quality of the colostrum is determined, among other things, by the IgG content. This may be evaluated in the colostrum by direct and indirect methods (density and refractive index). The density of the colostrum is measured by a colostrometer and should amount to at least 1060 g/l. Refractometry is suitable for assessing the relative density or refractive index. Good equine colostrum has a Brix value of at leas...
Transendoscopic correction of epiglottic entrapment with a silicone-covered laser guide and diode laser in 29 horses.
Veterinary surgery : VS    October 21, 2019   Volume 49, Issue 1 131-137 doi: 10.1111/vsu.13338
Beste KJ, Ortved KF, Rossignol F, Ducharme NG.To describe the use of a silicone-covered laser guide and diode laser for surgical correction of epiglottic entrapment and report postoperative outcomes in horses with epiglottic entrapment. Methods: Retrospective case series. Methods: Thoroughbred and standardbred racehorses (n = 29) with epiglottic entrapment. Methods: A silicone-covered laser guide was placed endoscopically to direct the diode laser cutting action during transection of the entrapping subepiglottic membrane and to act as a physical barrier between the membrane and the epiglottic cartilage. Postoperative complications and tra...
[Cervical Stent for Long-term Treatment of Pyometra in Mares].
Tierarztliche Praxis. Ausgabe G, Grosstiere/Nutztiere    October 21, 2019   Volume 47, Issue 5 327-328 doi: 10.1055/a-1004-9876
Krohn J, Ennen S, Hospes R et al. Use of a cervical stent for long-term treatment of pyometra in the mare: A report of three cases. Reprod Dom Anim 2019; 55: 1155–1159 DIE PYOMETRA DER STUTE IST EIN CHRONISCHER ENTZüNDUNGSZUSTAND DES ENDOMETRIUMS, DER HäUFIG MIT DER AKKUMULATION GROßER MENGEN AN SEKRET EINHERGEHT. PRäDISPONIERT SIND STUTEN MIT VERäNDERUNGEN DER ZERVIX, DURCH DIE DIE UTERINE CLEARANCE BEEINTRäCHTIGT WIRD. DIE HäUFIG UNSPEZIFISCHEN SYMPTOME UMFASSEN LEISTUNGSMANGEL, KONDITIONSVERLUST, SUBFEBRILE TEMPERATUR ODER KOLIKARTIGE SCHMERZEN. MANCHE TIERE PRäSENTIEREN SICH SYMP...
The Effect of Tree Width on Thoracolumbar and Limb Kinematics, Saddle Pressure Distribution, and Thoracolumbar Dimensions in Sports Horses in Trot and Canter.
Animals : an open access journal from MDPI    October 21, 2019   Volume 9, Issue 10 doi: 10.3390/ani9100842
MacKechnie-Guire R, MacKechnie-Guire E, Fairfax V, Fisher D, Fisher M, Pfau T.This study evaluated the effect of saddle tree width on thoracolumbar and limb kinematics, saddle pressure distribution, and thoracolumbar epaxial musculature dimensions. Correctly fitted saddles were fitted by a Society of Master Saddler Qualified Saddle Fitter in fourteen sports horses (mean ± SD age 12 ± 8.77 years, height 1.65 ± 0.94 m), and were altered to one width fitting wider and narrower. Horses were equipped with skin markers, inertial measurement units, and a pressure mat beneath the saddle. Differences in saddle pressure distribution, as well as limb and thoracolumbosacral kine...
Systemic Administration of Rejuvenated Adipose-Derived Mesenchymal Stem Cells Improves Liver Metabolism in Equine Metabolic Syndrome (EMS)- New Approach in Veterinary Regenerative Medicine.
Stem cell reviews and reports    October 18, 2019   Volume 15, Issue 6 842-850 doi: 10.1007/s12015-019-09913-3
Marycz K, Szłapka-Kosarzewska J, Geburek F, Kornicka-Garbowska K.Equine metabolic syndrome (EMS) is characterized by adiposity, insulin dysregulation and increased risk for laminitis. Increased levels of specific liver enzymes in the peripheral blood are typical findings in horses diagnosed with EMS. Current management of EMS is based on caloric restriction and increased physical activity. However, new potential treatment options are arising such as the transplantation of autologous adipose stem cells (ASC). However, cytophysiological properties of ASC derived from EMS horses are impaired which strongly limits their therapeutic potential. We hypothesized, t...
Characterization of abortion, stillbirth and non-viable foals homozygous for the Warmblood Fragile Foal Syndrome.
Animal reproduction science    October 17, 2019   Volume 211 106202 doi: 10.1016/j.anireprosci.2019.106202
Aurich C, Müller-Herbst S, Reineking W, Müller E, Wohlsein P, Gunreben B, Aurich J.Warmblood fragile foal syndrome (WFFS) is a monogenetic defect with autosomal recessive inheritance. The WFFS homozygosity is non-compatible with extra-uterine life. Although as many as 15% of Warmblood horses are WFFS carriers, there has been little veterinary focus on this condition. The aim of this study was to determine outcomes and symptoms of clinical signs and pathological abnormalities during pregnancies when there were WFFS homozygous foetuses. Diagnostic material of 15 abortion or stillbirth cases with suspected diagnosis of WFFS was available for this study. Additionally, there were...
Ultrasonographic assessment of normal jugular veins in Standardbred horses.
BMC veterinary research    October 16, 2019   Volume 15, Issue 1 343 doi: 10.1186/s12917-019-2104-5
Pasolini MP, Spinella G, Del Prete C, Valentini S, Coluccia P, Auletta L, Greco M, Meomartino L.Ultrasonography (US) is the recommended imaging technique to evaluate jugular veins. This prospective randomized clinical study was designed to collect a series of B-mode US measurements of manually distended jugular veins in healthy Italian Standardbreds and to find possible correlations between ultrasound measurements and animal morphometric characteristics. Forty-two horses, eight males and 34 females (range 3-22 years; bodyweight 494.4 ± 41.7 kg), were included in the study. The diameters and wall thicknesses of both jugular veins were measured at three different sites of the neck...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Fungal Placentitis Caused by Aspergillus terreus in a Mare: Case Report.
Journal of equine veterinary science    October 15, 2019   Volume 83 102799 doi: 10.1016/j.jevs.2019.102799
Orellana-Guerrero D, Renaudin C, Edwards L, Rose E, Aleman M, Moore PF, Dujovne G.Placentitis has been reported as the most important cause of equine abortions, stillbirths, and perinatal deaths in horses. Most cases are caused by bacteria and less commonly by fungal elements. The aim of this report is to describe the clinical presentation of a fungal placentitis caused by Aspergillus terrerus. A 5-year-old thoroughbred maiden mare at the 217th day of gestation presented with some classic signs of placentitis (premature udder development and milk dripping). All ultrasonographic findings were consistent with a live fetus and a severe placentitis. On vaginal examination, pur...
Outcome and complications in horses administered sterile or non-sterile fluids intravenously.
Journal of veterinary internal medicine    October 14, 2019   Volume 33, Issue 6 2739-2745 doi: 10.1111/jvim.15631
Kopper JJ, Bolger ME, Kogan CJ, Schott HC.Obtaining commercial fluids for intravenous administration (IVF) was challenging during a recent shortage. This necessitated use of custom-made non-sterile fluids for intravenous administration (JUGs) in some hospitals. There are no studies comparing outcome of horses treated with JUG versus IVF and limited information is available about adverse effects of JUGs. Objective: To evaluate death, complications, blood pH, and plasma electrolyte concentrations of horses that received JUG versus IVFs. Methods: One hundred eighty-six horses that received IVFs and 37 that received JUGs. Methods: A retro...
A candidate-SNP retrospective cohort study for fracture risk in Japanese Thoroughbred racehorses.
Animal genetics    October 14, 2019   Volume 51, Issue 1 43-50 doi: 10.1111/age.12866
Tozaki T, Kusano K, Ishikawa Y, Kushiro A, Nomura M, Kikuchi M, Kakoi H, Hirota K, Miyake T, Hill EW, Nagata S.Fractures are medical conditions that compromise the athletic potential of horses and/or the safety of jockeys. Therefore, the reduction of fracture risk is an important horse and human welfare issue. The present study used molecular genetic approaches to determine the effect of genetic risk for fracture at four candidate SNPs spanning the myostatin (MSTN) gene on horse chromosome 18. Among the 3706 Japanese Thoroughbred racehorses, 1089 (29.4%) had experienced fractures in their athletic life, indicating the common occurrence of this injury in Thoroughbreds. In the case/control association st...
Thermal, mechanical and electrical stimuli in antinociceptive studies in standing horses: an update.
Veterinary anaesthesia and analgesia    October 13, 2019   Volume 47, Issue 1 15-27 doi: 10.1016/j.vaa.2019.09.003
Gozalo-Marcilla M, Luna SPL, Gasthuys F, Schauvliege S.To perform a literature review of the thermal and mechanical antinociceptive devices used in pharmacological studies in standing horses published after 2011 (2012-2019). To complete a full literature review about electrical stimulation used for evaluation in similar studies. Methods: PubMed, Google Scholar and Web of Science. Conclusions: A high level of standardization has been reached in antinociceptive studies in standing horses using thermal and mechanical stimuli in most recent years. Commercially available testing devices to deliver thermal, mechanical and electrical stimuli, with observ...
Preliminary insight into horse owners’ perceptions of, and attitudes towards, exotic diseases in the United Kingdom.
BMC veterinary research    October 12, 2019   Volume 15, Issue 1 338 doi: 10.1186/s12917-019-2120-5
Spence KL, Cardwell JM, Slater J, Rosanowski SM.The potential for an exotic disease incursion is a significant concern for the United Kingdom (UK) equine industry. Horse owners' perceptions of, and attitudes towards, exotic diseases can influence decisions to adopt disease preparedness strategies. The objectives of this study were to describe horse owners' 1) perceptions of the term 'exotic disease', and 2) attitudes towards their risk of being affected by an exotic disease. In order to address these objectives, qualitative content analysis was undertaken on data collected using two open-ended survey questions. Results: Horse owners (n =â€...
Multiple excisions of an equine sarcoid and the repercussions.
The Canadian veterinary journal = La revue veterinaire canadienne    October 11, 2019   Volume 60, Issue 10 1115-1117 
Melinyshyn H.A 13-year-old Morgan crossbred mare was presented in May 2018 with a 10-cm mass on the medial aspect of the left hind fetlock. In September and November 2018 and June 2019 the mass was incompletely excised and continued to grow. A diagnosis of spindle cell tumor, consistent with equine sarcoid, was made based on histopathology from the last excision. . Une jument Morgan croisée âgée de 13 ans a été présentée en mai 2018 avec une masse de 10 cm sur l’aspect médial du boulet arrière gauche. En septembre et novembre 2018 ainsi qu’en juin 2019, la masse avait été excisée de manièr...
Sacrococcygeal luxation and complete tail amputation following a tail pull injury in a horse.
The Canadian veterinary journal = La revue veterinaire canadienne    October 11, 2019   Volume 60, Issue 10 1094-1098 
Riddell LP, Yoshimura S, MacKay AV, Wilson DG.A 17-year-old Quarter horse mare was presented because of traumatic luxation of the fifth sacral and first coccygeal vertebrae resulting in loss of sensation, motor function, and perfusion of the tail. The case was complicated by an associated tail head hematoma. Due to the severity of the injury, tail amputation was performed at the level of the luxation. Tail amputations in horses at the sacrococcygeal junction following a suspected tail pull injury are infrequently reported in the literature. . Une jument Quarter horse âgée de 17 ans fut présentée pour cause de luxation traumatique de l...
Culture-independent and dependent evaluation of the equine paranasal sinus microbiota in health and disease.
Equine veterinary journal    October 10, 2019   Volume 52, Issue 3 455-463 doi: 10.1111/evj.13168
Beste KJ, Lawhon SD, Chamoun-Emanuelli AM, Duff AH, Coleman MC, Griffin CE, Hardy J, Whitfield-Cargile CM.Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...
Positive Reinforcement-Based Training for Self-Loading of Meat Horses Reduces Loading Time and Stress-Related Behavior.
Frontiers in veterinary science    October 10, 2019   Volume 6 350 doi: 10.3389/fvets.2019.00350
Dai F, Dalla Costa A, Bonfanti L, Caucci C, Di Martino G, Lucarelli R, Padalino B, Minero M.The present work aimed to evaluate the efficacy of a self-loading training using positive reinforcement on stress-related behaviors shown by meat horses during loading procedures into a truck. Thirty-two meat horses ( = 18; = 14; 6 month-old) were included in the study. All horses had limited interactions with the farmer and were not used to be restrained nor lead by halter. Horses were divided in two groups: Control Group (C; = 14) and Training Group (T; = 18). T horses were trained to self-load: in order to teach the horses to enter into the truck, a targeting training technique throughou...
History, clinical findings and outcome of horses with radiographical signs of equine odontoclastic tooth resorption and hypercementosis.
The Veterinary record    October 10, 2019   Volume 185, Issue 23 730 doi: 10.1136/vr.105253
Rahmani V, Häyrinen L, Kareinen I, Ruohoniemi M.The progression of equine odontoclastic tooth resorption and hypercementosis (EOTRH) has not been completely evaluated, and currently, the only effective treatment is extraction of severely affected teeth. We aim to describe how the disease relates to the history and clinical findings and to report on the outcome in individual horses. This case series comprises data collected from 20 horses (age 14-29 years old) with radiographic findings of EOTRH in their incisor and/or canine teeth. Most horses affected with EOTRH in this study were admitted for dental problems, but some for other complaints...
Risk factors for exertional heat illness in Thoroughbred racehorses in flat races in Japan (2005-2016).
Equine veterinary journal    October 6, 2019   Volume 52, Issue 3 364-368 doi: 10.1111/evj.13179
Takahashi Y, Takahashi T.Exertional heat illness (EHI) is recognised in horses, but few reports have investigated its risk factors. Objective: To identify risk factors for EHI in racehorses participating in flat races in Japan. Methods: Descriptive epidemiology and retrospective unmatched case-control study. Methods: Between 2005 and 2016, veterinary records of horses diagnosed with EHI after flat races were reviewed retrospectively and data of the months from April to September were used for a case-control study. For each case, three control horses were randomly selected from starts between April and September. Race ...
Clinical insights: The equine microbiome.
Equine veterinary journal    October 5, 2019   Volume 51, Issue 6 714-715 doi: 10.1111/evj.13165
Murcia PR.No abstract available
Clinical insights: Antimicrobials in an age of resistance.
Equine veterinary journal    October 5, 2019   Volume 51, Issue 6 711-713 doi: 10.1111/evj.13151
Mercer MA, Davis JL.No abstract available
Equine gait analysis: The slow start, the recent breakthroughs and the sky as the limit?
Equine veterinary journal    October 5, 2019   Volume 51, Issue 6 809-810 doi: 10.1111/evj.13161
van Weeren PR, Gómez Álvarez CB.No abstract available
Autogenous transfer of intracytoplasmic sperm injection-produced equine embryos into the uterus of the oocyte donor during the same oestrous cycle.
Reproduction, fertility, and development    October 5, 2019   Volume 31, Issue 12 1912-1916 doi: 10.1071/RD19253
Rossini JB, Rodriguez J, Bresnahan DR, Stokes JE, Carnevale EM.The clinical use of intracytoplasmic sperm injection (ICSI) in horses usually involves the transfer of embryos into recipient mares, resulting in substantial cost increases. This is essential when subfertile mares are oocyte donors; but some donors are fertile, with ICSI compensating for limited or poor-quality spermatozoa. Fertile oocyte donors could carry pregnancies, eliminating the need for a recipient. We assessed the potential of using oocyte donors as recipients for their own ICSI-produced embryos during the same cycle. Donors in oestrus and with large dominant follicles were administer...
The Equine Gingiva: A Gross Anatomical Evaluation.
Frontiers in veterinary science    October 4, 2019   Volume 6 322 doi: 10.3389/fvets.2019.00322
Steinfort S, Obach-Schröck C, Röcken M, Theiss F, Failing K, Vogelsberg J, Staszyk C.Equine periodontal disease (ePD) usually starts with food impaction, formation of diastemata, gingival inflammation and formation of periodontal pockets. This process proceeds toward the dentoalveolar space, causing detachment of tooth supporting periodontal fibers. Although several therapeutical procedures have been proposed, ePD is often only diagnosed in advanced stages, requiring dental extraction. A similar dilemma has been observed in small animal medicine, but has been overcome by the introduction of reliable examination protocols for the early diagnosis of periodontal diseases (PD). Th...
Pharmacokinetics of intravenous and oral administration of enrofloxacin to the late-term pregnant and non-pregnant mares.
Equine veterinary journal    October 4, 2019   Volume 52, Issue 3 464-470 doi: 10.1111/evj.13175
Ellerbrock RE, Curcio BR, Zhong L, Honoroto J, Wilkins P, Lima FS, Giguere S, Canisso IF.Enrofloxacin may be an alternative antimicrobial for unresponsive cases of severe bacterial infections in pregnant mares. As pregnancy may affect drug bioavailability, distribution, metabolism and excretion, dose adjustment might be necessary. Objective: To determine the disposition of orally and intravenously administered enrofloxacin in pregnant and non-pregnant mares. Methods: Randomised cross-over experiment. Methods: Six light-breed, healthy pregnant mares (260 days gestation) were given a single dose of either intravenous (5 mg/kg bwt) or oral compounded (7.5 mg/kg bwt) enrofloxacin, ...
Clinical Pharmacology in Donkeys and Mules.
The Veterinary clinics of North America. Equine practice    October 3, 2019   Volume 35, Issue 3 589-606 doi: 10.1016/j.cveq.2019.08.011
Mendoza FJ, Perez-Ecija A, Toribio RE.Donkeys and mules show several pharmacodynamic and pharmacokinetic idiosyncrasies that have to be fully considered by any clinician dealing with these species. Because they possess an increased metabolic rate and cellular water content compared with horses, higher doses (or shorter dosing intervals) are usually recommended for those drugs where pharmacologic studies have been performed. Nonetheless, owing to the lack of species-specific information, this assumption cannot be arbitrarily applied. Thus, when a drug protocol published for horses is extrapolated to a donkey or a mule, a close moni...
Donkey Nutrition and Malnutrition.
The Veterinary clinics of North America. Equine practice    October 3, 2019   Volume 35, Issue 3 469-479 doi: 10.1016/j.cveq.2019.08.004
Burden FA, Bell N.The domestic donkey is a unique equid species with specific nutritional requirements. This article examines the importance of feeding strategies that mimic the donkey's natural environment using poor nutritional quality fibers and access to browsing materials. The relationship between nutrition and health is examined and practical approaches to the healthy and sick donkey are discussed.
Pregnancy obtained in a late gestational mare by in vitro embryo production.
Reproduction, fertility, and development    October 3, 2019   Volume 31, Issue 12 1926-1929 doi: 10.1071/RD19305
Campos-Chillon LF, Martin J, Altermatt JL.Recently, the demand for invitro embryo production in the horse has increased worldwide. Most clinical transvaginal ultrasound-guided ovum pick-up (OPU) procedures are performed in non-pregnant donor mares, and few experimental studies have described invitro embryo production from oocytes of pregnant donors 21-150 days in gestation. This report discusses OPU, follicular growth and invitro embryo production in a pregnant mare during late gestation.
Anesthesia, Sedation, and Pain Management of Donkeys and Mules.
The Veterinary clinics of North America. Equine practice    October 3, 2019   Volume 35, Issue 3 515-527 doi: 10.1016/j.cveq.2019.08.007
Matthews N, van Loon JPAM.The number of donkeys in the world may not be increasing but awareness of their use and concern for welfare and pain recognition and treatment are receiving increasing veterinary interest. Therefore, accurate information about anesthesia and analgesia in donkeys and mules is important to more equine practitioners. This review highlights the current knowledge on various anesthetic and analgesic approaches in donkey and mules. The authors emphasize that there is still much information that is not available about donkeys and mules; in many circumstances, the clinician must use available equine in...