Analyze Diet

Topic:Comparative Study

Comparative studies in equine research involve the systematic analysis of different horse breeds, management practices, or physiological responses to identify variations and similarities. These studies are instrumental in understanding how different factors influence health, performance, and behavior in horses. Common areas of comparison include genetic traits, nutritional requirements, disease resistance, and response to training. By evaluating these differences, researchers can develop targeted strategies for breeding, healthcare, and training. This page aggregates peer-reviewed research studies and scholarly articles that focus on the methodologies, findings, and implications of comparative studies in the context of equine science.
The mule (Equus mulus) as a recipient of horse (Equus caballus) embryos: Comparative aspects of early pregnancy with mares.
Theriogenology    October 30, 2019   Volume 145 217-225 doi: 10.1016/j.theriogenology.2019.10.029
Camargo CE, Rechsteiner SF, Macan RC, Kozicki LE, Gastal MO, Gastal EL.The aim of this study was to compare the embryonic and early fetal development of horse embryos between recipient mules and mares from day 10-60 of pregnancy, in addition to hormonal (eCG and progesterone), ovarian, and uterine characteristics for approximately 4 months. Embryo donor mares (n = 5) and two groups of recipients (acyclic mules, n = 7; cyclic mares, n = 7) were used. Donor mares were monitored daily by transrectal ultrasonography and inseminated using fresh semen. Cyclic recipient mares were synchronized with the donor's ovulation using PGF2α and deslorelin acetate. M...
Enteroinsular axis response to carbohydrates and fasting in healthy newborn foals.
Journal of veterinary internal medicine    October 30, 2019   Volume 33, Issue 6 2752-2764 doi: 10.1111/jvim.15641
Rings LM, Swink JM, Dunbar LK, Burns TA, Toribio RE.The enteroinsular axis (EIA) comprises intestinal factors (incretins) that stimulate insulin release after PO ingestion of nutrients. Glucose-dependent insulinotropic polypeptide (GIP) and glucagon-like peptide-1 (GLP-1) are the main incretins. The EIA has not been investigated in healthy neonatal foals but should be important because energy demands are high in healthy foals and dysregulation is frequent in sick foals. Objective: To evaluate the EIA response to carbohydrates or fasting in newborn foals. We hypothesized that incretin secretion would be higher after PO versus IV carbohydrate adm...
Estimation of glomerular filtration rate by plasma clearance of iohexol in healthy horses of various ages.
Journal of veterinary internal medicine    October 30, 2019   Volume 33, Issue 6 2765-2769 doi: 10.1111/jvim.15642
Plasma clearance of iohexol is a reliable method to assess the glomerular filtration rate (GFR). The relationship between aging and GFR in horses is unclear. To compare GFR estimated by iohexol clearance in horses of different ages. Twenty-one clinically healthy horses were enrolled. Prospective study. Groups: (A) composed by 8 young horses (≤14 years old) with serum creatinine <1.5 mg/dL, (B) by 7 aged horses (≥20 years old) with serum creatinine <1.5 mg/dL, and (C) by 6 aged horses (≥20 years old) with serum creatinine ≥1.5 mg/dL. Iohexol was injected (75.5 mg/kg) through...
Exercise Induced Laryngeal Obstruction in Humans and Equines. A Comparative Review.
Frontiers in physiology    October 30, 2019   Volume 10 1333 doi: 10.3389/fphys.2019.01333
Fretheim-Kelly ZL, Halvorsen T, Clemm H, Roksund O, Heimdal JH, Vollsæter M, Fintl C, Strand E.Dynamic obstructions of the larynx are a set of disorders that occur during exercise in equines and humans. There are a number of similarities in presentation, diagnosis, pathophysiology and treatment. Both equines and humans present with exercise intolerance secondary to dyspnea. During laryngoscopy at rest, the larynx appears to function normally. Abnormalities are only revealed during laryngoscopy at exercise, seemingly triggered by increased ventilatory demands, and quickly resolve after cessation of exercise. Lower airway disease (asthma being the most prevalent condition), cardiac diseas...
Impact of alpha-tocopherol deficiency and supplementation on sacrocaudalis and gluteal muscle fiber histopathology and morphology in horses.
Journal of veterinary internal medicine    October 29, 2019   Volume 33, Issue 6 2770-2779 doi: 10.1111/jvim.15643
Bookbinder L, Finno CJ, Firshman AM, Katzman SA, Burns E, Peterson J, Dahlgren A, Ming-Whitfield B, Glessner S, Borer-Matsui A, Valberg SJ.A subset of horses deficient in alpha-tocopherol (α-TP) develop muscle atrophy and vitamin E-responsive myopathy (VEM) characterized by mitochondrial alterations in the sacrocaudalis dorsalis medialis muscle (SC). Objective: To quantify muscle histopathologic abnormalities in subclinical α-TP deficient horses before and after α-TP supplementation and compare with retrospective (r)VEM cases. Methods: Prospective study; 16 healthy α-TP-deficient Quarter Horses. Retrospective study; 10 retrospective vitamin E-responsive myopathy (rVEM) cases . Methods: Blood, SC, and gluteus medius (GM) biops...
Plasma adrenocorticotropic hormone concentration in horses decreases after freezing for 60 days. Haffner JC, Neal DL, Hoffman RM, Grubbs ST.We investigated the stability of adrenocorticotropic hormone (ACTH) in plasma after freezing for different lengths of time. The plasma ACTH concentrations of 12 horses were measured on day 0 (baseline) and over time, after stimulation with thyrotropin-releasing hormone. Samples were stored at -80°C for 3, 7, 30, 60, and 90 d, or at -20°C for 3, 7, 30, and 60 d, or between ice packs at -20°C for 3 and 7 d prior to determination of ACTH concentration. ACTH concentrations were compared to baseline (non-frozen day 0 plasma) for each storage method using a mixed model with repeated measure...
Comparison of sperm selection techniques in donkeys: motile subpopulations from a practical point of view.
Animal reproduction    October 23, 2019   Volume 16, Issue 2 282-289 doi: 10.21451/1984-3143-AR2018-0133
Ortiz I, Dorado J, Morrell JM, Diaz-Jimenez MA, Pereira B, Consuegra C, Hidalgo M.The aim of this study was to compare the post-thaw distribution of motile sperm subpopulations, following simple or colloid centrifugation. A new analysis was used to evaluate the available number of sperm from each subpopulation after each centrifugation protocol. Frozen/thawed semen samples were divided into the following after-thawing treatments: uncentrifuged control (UDC), sperm washing (SW) and two colloid centrifugation procedures (Equipure, SLC-E, and Androcoll, SLC-A). Percentage of total and progressive motility (TM and PM), as well as sperm motility kinematics, distribution of motil...
Can we use LDL instead of egg yolk in BotuCrio® extender to cryopreserve sperm from the Mangalarga Marchador stallion?
Animal reproduction    October 23, 2019   Volume 16, Issue 2 340-347 doi: 10.21451/1984-3143-AR2019-0039
Snoeck PPDN, Pessoa THO, Pereira MGS, Bastos ICL, de Melo MIV.The objective of this study was to compare the BotuCrio extender with the Merk - egg yolk and the INRA 82 modified by the inclusion of acetamide, methyl cellulose and trehalose in substitution of glycerol for freezing equine semen. The semen was diluted after centrifugation to obtain 100 x 10 of sperm/ml in: BotuCrio (control); Merk - egg yolk or INRA 82 modified (Experiment 1). The extended semen was packaged in 0.5 ml straws, cooled and frozen in a freezing machine. The control extender was superior in preserving the motility, VCL, VSL, VAP, LIN, STR and the BCF when compared to the Merk - e...
Equine non-invasive time-lapse imaging and blastocyst development.
Reproduction, fertility, and development    October 22, 2019   Volume 31, Issue 12 1874-1884 doi: 10.1071/RD19260
Meyers S, Burruel V, Kato M, de la Fuente A, Orellana D, Renaudin C, Dujovne G.In this study we examined the timeline of mitotic events of invitro-produced equine embryos that progressed to blastocyst stage using non-invasive time-lapse microscopy (TLM). Intracytoplasmic sperm injection (ICSI) embryos were cultured using a self-contained imaging incubator system (Miri®TL; Esco Technologies) that captured brightfield images at 5-min intervals that were then generated into video for retrospective analysis. For all embryos that progressed to the blastocyst stage, the initial event of extrusion of acellular debris preceded all first cleavages and occurred at mean (±s.e.m.)...
Differences in microbiome and virome between cattle and horses in the same farm.
Asian-Australasian journal of animal sciences    October 22, 2019   Volume 33, Issue 6 1042-1055 doi: 10.5713/ajas.19.0267
Park J, Kim EB.The ecosystem of an animal farm is composed of various elements, such as animals, farmers, plants, feed, soil, and microorganisms. A domesticated animal's health is largely connected with the reservoir of bacteria and viruses in animal farms. Although a few studies have focused on exploring the gut microbiome of animals, communities of microbiota and viruses in feedlots have not been thoroughly investigated. Methods: Here, we collected feces and dust samples (4 groups: cattle feces, C_F; horse feces, H_F; cattle dust, C_D; and horse dust, H_D) from cattle and horse farms sharing the same housi...
Inter- and intra-breed genome-wide copy number diversity in a large cohort of European equine breeds.
BMC genomics    October 22, 2019   Volume 20, Issue 1 759 doi: 10.1186/s12864-019-6141-z
Solé M, Ablondi M, Binzer-Panchal A, Velie BD, Hollfelder N, Buys N, Ducro BJ, François L, Janssens S, Schurink A, Viklund Å, Eriksson S....Copy Number Variation (CNV) is a common form of genetic variation underlying animal evolution and phenotypic diversity across a wide range of species. In the mammalian genome, high frequency of CNV differentiation between breeds may be candidates for population-specific selection. However, CNV differentiation, selection and its population genetics have been poorly explored in horses. Results: We investigated the patterns, population variation and gene annotation of CNV using the Axiom® Equine Genotyping Array (670,796 SNPs) from a large cohort of individuals (N = 1755) belonging to eight ...
Investigation of stemness and multipotency of equine adipose-derived mesenchymal stem cells (ASCs) from different fat sources in comparison with lipoma.
Stem cell research & therapy    October 22, 2019   Volume 10, Issue 1 309 doi: 10.1186/s13287-019-1429-0
Arnhold S, Elashry MI, Klymiuk MC, Geburek F.Adipose tissue-derived mesenchymal stem cells (ASCs) offer a promising cell source for therapeutic applications in musculoskeletal disorders. The appropriate selection of ASCs from various fat depots for cell-based therapy is challenging. The present study aims to compare stemness and multipotency of ASCs derived from retroperitoneal (RP), subcutaneous (SC), and lipoma (LP) fat to assess their usefulness for clinical application. Equine ASCs from the three fat tissue sources were isolated and characterized. The cell viability, proliferation, and self-renewal were evaluated using MTT, sulforhod...
Possible dysmetabolic hyperferritinemia in hyperinsulinemic horses.
Open veterinary journal    October 21, 2019   Volume 9, Issue 4 287-293 doi: 10.4314/ovj.v9i4.2
Kellon EM, Gustafson KM.Hyperinsulinemia associated with equine metabolic syndrome and pituitary pars intermedia dysfunction is a risk factor for laminitis. Research in other species has shown elevated body iron levels as both a predictor and consequence of insulin resistance. In humans, this is known as dysmetabolic hyperferritinemia. To explore the relationship between equine hyperinsulinemia and body iron levels. We reviewed case histories and laboratory results from an open access database maintained by the Equine Cushing's and Insulin Resistance Group Inc. (ECIR). We identified 33 horses with confirmed hyperinsu...
Longitudinal study of electrical, functional and structural remodelling in an equine model of atrial fibrillation.
BMC cardiovascular disorders    October 21, 2019   Volume 19, Issue 1 228 doi: 10.1186/s12872-019-1210-4
Hesselkilde EZ, Carstensen H, Flethøj M, Fenner M, Kruse DD, Sattler SM, Tfelt-Hansen J, Pehrson S, Braunstein TH, Carlson J, Platonov PG....Large animal models are important in atrial fibrillation (AF) research, as they can be used to study the pathophysiology of AF and new therapeutic approaches. Unlike other animal models, horses spontaneously develop AF and could therefore serve as a bona fide model in AF research. We therefore aimed to study the electrical, functional and structural remodelling caused by chronic AF in a horse model. Nine female horses were included in the study, with six horses tachypaced into self-sustained AF and three that served as a time-matched sham-operated control group. Acceleration in atrial fibrilla...
The Effect of Tree Width on Thoracolumbar and Limb Kinematics, Saddle Pressure Distribution, and Thoracolumbar Dimensions in Sports Horses in Trot and Canter.
Animals : an open access journal from MDPI    October 21, 2019   Volume 9, Issue 10 doi: 10.3390/ani9100842
MacKechnie-Guire R, MacKechnie-Guire E, Fairfax V, Fisher D, Fisher M, Pfau T.This study evaluated the effect of saddle tree width on thoracolumbar and limb kinematics, saddle pressure distribution, and thoracolumbar epaxial musculature dimensions. Correctly fitted saddles were fitted by a Society of Master Saddler Qualified Saddle Fitter in fourteen sports horses (mean ± SD age 12 ± 8.77 years, height 1.65 ± 0.94 m), and were altered to one width fitting wider and narrower. Horses were equipped with skin markers, inertial measurement units, and a pressure mat beneath the saddle. Differences in saddle pressure distribution, as well as limb and thoracolumbosacral kine...
Refinement of Global Domestic Horse Biogeography Using Historic Landrace Chinese Mongolian Populations.
The Journal of heredity    October 20, 2019   Volume 110, Issue 7 769-781 doi: 10.1093/jhered/esz032
Han H, Bryan K, Shiraigol W, Bai D, Zhao Y, Bao W, Yang S, Zhang W, MacHugh DE, Dugarjaviin M, Hill EW.The Mongolian horse is one of the oldest extant horse populations and although domesticated, most animals are free-ranging and experience minimal human intervention. As an ancient population originating in one of the key domestication centers, the Mongolian horse may play a key role in understanding the origins and recent evolutionary history of horses. Here we describe an analysis of high-density genome-wide single-nucleotide polymorphism (SNP) data in 40 globally dispersed horse populations (n = 895). In particular, we have focused on new results from Chinese Mongolian horses (n = 100) that ...
Relationship between DNA fragmentation of equine granulosa cells and oocyte meiotic competence after in vitro maturation.
Reproduction in domestic animals = Zuchthygiene    October 19, 2019   Volume 54 Suppl 4 78-81 doi: 10.1111/rda.13514
Pereira B, Dorado J, Diaz-Jimenez M, Consuegra C, Ortiz I, Gosalvez J, Hidalgo M.The acquisition of equine oocyte developmental capacity is ensured by the follicular environment, such as granulosa cells, which could reflect the meiotic development potential of immature oocytes. This study evaluated the relationship between DNA fragmentation of granulosa cells, using the chromatin dispersion test, and equine oocyte meiotic development after in vitro maturation. Granulosa cells and cumulus-oocytes complexes (n = 50) were recovered from slaughterhouse-derived ovaries. Oocytes were in vitro matured, stained and evaluated under fluorescence microscopy. Maturation rates were c...
Alternatives in Donkey semen cryopreservation: Mare vs. Jenny Colostrum.
Reproduction in domestic animals = Zuchthygiene    October 19, 2019   Volume 54 Suppl 4 94-97 doi: 10.1111/rda.13516
Álvarez C, González N, Luño V, Martínez F, Gil L.The aim of this study was to test and compare two new components in extenders for freezing donkey semen: mare colostrum and jenny colostrum. Colostrum was obtained from four mares and four jennies right after the foal's birth. Ejaculates were collected from five fertile donkeys. Sperm samples were pooled, diluted and cryopreserved in three different experimental extender groups: lactose supplemented with egg yolk extender (20%) as the control group, lactose supplemented with jenny colostrum extender (20%), and lactose supplemented with mare colostrum extender (20%). After thawing, we evaluated...
Frameshift Variant in MFSD12 Explains the Mushroom Coat Color Dilution in Shetland Ponies.
Genes    October 19, 2019   Volume 10, Issue 10 826 doi: 10.3390/genes10100826
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Non-Coding RNA Sequencing of Equine Endometrium During Maternal Recognition of Pregnancy.
Genes    October 18, 2019   Volume 10, Issue 10 821 doi: 10.3390/genes10100821
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Effects of Different Freezing Protocols on Motility, Viability, Mitochondrial Membrane Potential, Intracellular Calcium Level, and DNA Integrity of Cryopreserved Equine Epididymal Sperm.
Journal of equine veterinary science    October 17, 2019   Volume 82 102801 doi: 10.1016/j.jevs.2019.102801
Neuhauser S, Bollwein H, Siuda M, Handler J.The aim of the present study was to evaluate the effect of different freezing procedures on sperm motion, viability, the acrosome status, mitochondrial membrane potential (MMP), intracellular calcium content, and DNA integrity on epididymal stallion sperm. Therefore, the sperm of 10 healthy stallions was harvested by retrograde flushing after testectomy, diluted with a semen extender containing defined milk proteins and a freezing extender containing egg yolk and glycerol and frozen according to 4 different protocols, using a programmable freezer and a floating rack performing a slow (processe...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Outcome and complications in horses administered sterile or non-sterile fluids intravenously.
Journal of veterinary internal medicine    October 14, 2019   Volume 33, Issue 6 2739-2745 doi: 10.1111/jvim.15631
Kopper JJ, Bolger ME, Kogan CJ, Schott HC.Obtaining commercial fluids for intravenous administration (IVF) was challenging during a recent shortage. This necessitated use of custom-made non-sterile fluids for intravenous administration (JUGs) in some hospitals. There are no studies comparing outcome of horses treated with JUG versus IVF and limited information is available about adverse effects of JUGs. Objective: To evaluate death, complications, blood pH, and plasma electrolyte concentrations of horses that received JUG versus IVFs. Methods: One hundred eighty-six horses that received IVFs and 37 that received JUGs. Methods: A retro...
Comparative Review of Asthma in Farmers and Horses.
Current allergy and asthma reports    October 10, 2019   Volume 19, Issue 11 50 doi: 10.1007/s11882-019-0882-2
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
Culture-independent and dependent evaluation of the equine paranasal sinus microbiota in health and disease.
Equine veterinary journal    October 10, 2019   Volume 52, Issue 3 455-463 doi: 10.1111/evj.13168
Beste KJ, Lawhon SD, Chamoun-Emanuelli AM, Duff AH, Coleman MC, Griffin CE, Hardy J, Whitfield-Cargile CM.Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...
Co-resistance to Amoxicillin and Tetracycline as an Indicator of Multidrug Resistance in Escherichia coli Isolates From Animals.
Frontiers in microbiology    October 9, 2019   Volume 10 2288 doi: 10.3389/fmicb.2019.02288
Bourély C, Cazeau G, Jarrige N, Jouy E, Haenni M, Lupo A, Madec JY, Leblond A, Gay E.To examine the relevance of co-resistance to amoxicillin and tetracycline as an indicator of multidrug resistance (MDR) in animal health. Methods: isolates collected between 2012 and 2016 by the French surveillance network for antimicrobial resistance in diseased animals (RESAPATH) were analyzed. The proportions of MDR isolates and the proportions of isolates presenting co-resistance to amoxicillin and tetracycline were calculated for seven animal species (cattle, horse, dog, swine, poultry, duck, and turkey). The degree of agreement between these two proportions was estimated by calculating ...
Development of the equine gut microbiota.
Scientific reports    October 8, 2019   Volume 9, Issue 1 14427 doi: 10.1038/s41598-019-50563-9
Lindenberg F, Krych L, Kot W, Fielden J, Frøkiær H, van Galen G, Nielsen DS, Hansen AK.Shortly after birth the mammalian gut is colonized, by a transient microbiota, highly susceptible to environment and diet, that eventually stabilizes and becomes the resident gut microbiota. In a window of opportunity during the colonization, oral tolerance is established towards resident bacteria. In this study, the development of the equine gut microbiota was investigated in ten foals from parturition until post weaning. We found great differences in the core species of the gut microbiota composition between time-matched samples on Day 7 and 20 post-partum. Between day 20 and Day 50 post-par...
In vitro-produced horse embryos exhibit a very narrow window of acceptable recipient mare uterine synchrony compared with in vivo-derived embryos.
Reproduction, fertility, and development    October 8, 2019   Volume 31, Issue 12 1904-1911 doi: 10.1071/RD19294
Cuervo-Arango J, Claes AN, Stout TAE.In recent years, the number of equine invitro-produced embryos (IVP) has increased markedly; as yet, there are few reports on what constitutes an 'ideal' recipient for an IVP embryo. This study retrospectively investigated the effects of recipient mare oestrous cycle characteristics on the likelihood of pregnancy after transfer of IVP (n=264) and invivo-derived embryos (n=262). IVP embryos tolerated only a narrow window of recipient mare 'synchrony', with transfer on Day 4 after ovulation resulting in a higher likelihood of ongoing pregnancy (69%) than transfer on Days 3, 5 or 6 (53.2%, 41.3% ...
An MRI study of solute transport in the intervertebral disc.
Magma (New York, N.Y.)    October 4, 2019   Volume 33, Issue 2 299-307 doi: 10.1007/s10334-019-00781-z
Palfrey RM, Summers IR, Winlove CP.Quantitative magnetic resonance imaging was used to determine partition coefficients and characteristic time constants for diffusion of MRI contrast agents in disc tissue. Methods: Twenty-two excised equine intervertebral discs were exposed to a range of contrast agents: six to manganese chloride, eight to Magnevist (gadopentetate dimeglumine) and eight to Gadovist (gadobutrol), and uptake into the disc was quantified in T-weighted images. Results: Diffusion for all contrast agents was approximately 25% faster in the nucleus than in the outer annulus; disc-average time constants ranged from (2...
Warmblood fragile foal syndrome type 1 mutation (PLOD1 c.2032G>A) is not associated with catastrophic breakdown and has a low allele frequency in the Thoroughbred breed.
Equine veterinary journal    October 4, 2019   Volume 52, Issue 3 411-414 doi: 10.1111/evj.13182
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
1 60 61 62 63 64 411