Omneity® Pellets
All-In-One Vitamin & Mineral Pellet
Topic:Comparative Study
Comparative studies in equine research involve the systematic analysis of different horse breeds, management practices, or physiological responses to identify variations and similarities. These studies are instrumental in understanding how different factors influence health, performance, and behavior in horses. Common areas of comparison include genetic traits, nutritional requirements, disease resistance, and response to training. By evaluating these differences, researchers can develop targeted strategies for breeding, healthcare, and training. This page aggregates peer-reviewed research studies and scholarly articles that focus on the methodologies, findings, and implications of comparative studies in the context of equine science.
Equine non-invasive time-lapse imaging and blastocyst development. In this study we examined the timeline of mitotic events of invitro-produced equine embryos that progressed to blastocyst stage using non-invasive time-lapse microscopy (TLM). Intracytoplasmic sperm injection (ICSI) embryos were cultured using a self-contained imaging incubator system (Miri®TL; Esco Technologies) that captured brightfield images at 5-min intervals that were then generated into video for retrospective analysis. For all embryos that progressed to the blastocyst stage, the initial event of extrusion of acellular debris preceded all first cleavages and occurred at mean (±s.e.m.)...
Differences in microbiome and virome between cattle and horses in the same farm. The ecosystem of an animal farm is composed of various elements, such as animals, farmers, plants, feed, soil, and microorganisms. A domesticated animal's health is largely connected with the reservoir of bacteria and viruses in animal farms. Although a few studies have focused on exploring the gut microbiome of animals, communities of microbiota and viruses in feedlots have not been thoroughly investigated. Methods: Here, we collected feces and dust samples (4 groups: cattle feces, C_F; horse feces, H_F; cattle dust, C_D; and horse dust, H_D) from cattle and horse farms sharing the same housi...
Inter- and intra-breed genome-wide copy number diversity in a large cohort of European equine breeds. Copy Number Variation (CNV) is a common form of genetic variation underlying animal evolution and phenotypic diversity across a wide range of species. In the mammalian genome, high frequency of CNV differentiation between breeds may be candidates for population-specific selection. However, CNV differentiation, selection and its population genetics have been poorly explored in horses. Results: We investigated the patterns, population variation and gene annotation of CNV using the Axiom® Equine Genotyping Array (670,796 SNPs) from a large cohort of individuals (N = 1755) belonging to eight ...
Investigation of stemness and multipotency of equine adipose-derived mesenchymal stem cells (ASCs) from different fat sources in comparison with lipoma. Adipose tissue-derived mesenchymal stem cells (ASCs) offer a promising cell source for therapeutic applications in musculoskeletal disorders. The appropriate selection of ASCs from various fat depots for cell-based therapy is challenging. The present study aims to compare stemness and multipotency of ASCs derived from retroperitoneal (RP), subcutaneous (SC), and lipoma (LP) fat to assess their usefulness for clinical application. Equine ASCs from the three fat tissue sources were isolated and characterized. The cell viability, proliferation, and self-renewal were evaluated using MTT, sulforhod...
Possible dysmetabolic hyperferritinemia in hyperinsulinemic horses. Hyperinsulinemia associated with equine metabolic syndrome and pituitary pars intermedia dysfunction is a risk factor for laminitis. Research in other species has shown elevated body iron levels as both a predictor and consequence of insulin resistance. In humans, this is known as dysmetabolic hyperferritinemia. To explore the relationship between equine hyperinsulinemia and body iron levels. We reviewed case histories and laboratory results from an open access database maintained by the Equine Cushing's and Insulin Resistance Group Inc. (ECIR). We identified 33 horses with confirmed hyperinsu...
Longitudinal study of electrical, functional and structural remodelling in an equine model of atrial fibrillation. Large animal models are important in atrial fibrillation (AF) research, as they can be used to study the pathophysiology of AF and new therapeutic approaches. Unlike other animal models, horses spontaneously develop AF and could therefore serve as a bona fide model in AF research. We therefore aimed to study the electrical, functional and structural remodelling caused by chronic AF in a horse model. Nine female horses were included in the study, with six horses tachypaced into self-sustained AF and three that served as a time-matched sham-operated control group. Acceleration in atrial fibrilla...
The Effect of Tree Width on Thoracolumbar and Limb Kinematics, Saddle Pressure Distribution, and Thoracolumbar Dimensions in Sports Horses in Trot and Canter. This study evaluated the effect of saddle tree width on thoracolumbar and limb kinematics, saddle pressure distribution, and thoracolumbar epaxial musculature dimensions. Correctly fitted saddles were fitted by a Society of Master Saddler Qualified Saddle Fitter in fourteen sports horses (mean ± SD age 12 ± 8.77 years, height 1.65 ± 0.94 m), and were altered to one width fitting wider and narrower. Horses were equipped with skin markers, inertial measurement units, and a pressure mat beneath the saddle. Differences in saddle pressure distribution, as well as limb and thoracolumbosacral kine...
Refinement of Global Domestic Horse Biogeography Using Historic Landrace Chinese Mongolian Populations. The Mongolian horse is one of the oldest extant horse populations and although domesticated, most animals are free-ranging and experience minimal human intervention. As an ancient population originating in one of the key domestication centers, the Mongolian horse may play a key role in understanding the origins and recent evolutionary history of horses. Here we describe an analysis of high-density genome-wide single-nucleotide polymorphism (SNP) data in 40 globally dispersed horse populations (n = 895). In particular, we have focused on new results from Chinese Mongolian horses (n = 100) that ...
Relationship between DNA fragmentation of equine granulosa cells and oocyte meiotic competence after in vitro maturation. The acquisition of equine oocyte developmental capacity is ensured by the follicular environment, such as granulosa cells, which could reflect the meiotic development potential of immature oocytes. This study evaluated the relationship between DNA fragmentation of granulosa cells, using the chromatin dispersion test, and equine oocyte meiotic development after in vitro maturation. Granulosa cells and cumulus-oocytes complexes (n = 50) were recovered from slaughterhouse-derived ovaries. Oocytes were in vitro matured, stained and evaluated under fluorescence microscopy. Maturation rates were c...
Alternatives in Donkey semen cryopreservation: Mare vs. Jenny Colostrum. The aim of this study was to test and compare two new components in extenders for freezing donkey semen: mare colostrum and jenny colostrum. Colostrum was obtained from four mares and four jennies right after the foal's birth. Ejaculates were collected from five fertile donkeys. Sperm samples were pooled, diluted and cryopreserved in three different experimental extender groups: lactose supplemented with egg yolk extender (20%) as the control group, lactose supplemented with jenny colostrum extender (20%), and lactose supplemented with mare colostrum extender (20%). After thawing, we evaluated...
Frameshift Variant in MFSD12 Explains the Mushroom Coat Color Dilution in Shetland Ponies. Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Non-Coding RNA Sequencing of Equine Endometrium During Maternal Recognition of Pregnancy. Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Effects of Different Freezing Protocols on Motility, Viability, Mitochondrial Membrane Potential, Intracellular Calcium Level, and DNA Integrity of Cryopreserved Equine Epididymal Sperm. The aim of the present study was to evaluate the effect of different freezing procedures on sperm motion, viability, the acrosome status, mitochondrial membrane potential (MMP), intracellular calcium content, and DNA integrity on epididymal stallion sperm. Therefore, the sperm of 10 healthy stallions was harvested by retrograde flushing after testectomy, diluted with a semen extender containing defined milk proteins and a freezing extender containing egg yolk and glycerol and frozen according to 4 different protocols, using a programmable freezer and a floating rack performing a slow (processe...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses. Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Outcome and complications in horses administered sterile or non-sterile fluids intravenously. Obtaining commercial fluids for intravenous administration (IVF) was challenging during a recent shortage. This necessitated use of custom-made non-sterile fluids for intravenous administration (JUGs) in some hospitals. There are no studies comparing outcome of horses treated with JUG versus IVF and limited information is available about adverse effects of JUGs. Objective: To evaluate death, complications, blood pH, and plasma electrolyte concentrations of horses that received JUG versus IVFs. Methods: One hundred eighty-six horses that received IVFs and 37 that received JUGs. Methods: A retro...
Comparative Review of Asthma in Farmers and Horses. Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
Culture-independent and dependent evaluation of the equine paranasal sinus microbiota in health and disease. Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...
Co-resistance to Amoxicillin and Tetracycline as an Indicator of Multidrug Resistance in Escherichia coli Isolates From Animals. To examine the relevance of co-resistance to amoxicillin and tetracycline as an indicator of multidrug resistance (MDR) in animal health. Methods: isolates collected between 2012 and 2016 by the French surveillance network for antimicrobial resistance in diseased animals (RESAPATH) were analyzed. The proportions of MDR isolates and the proportions of isolates presenting co-resistance to amoxicillin and tetracycline were calculated for seven animal species (cattle, horse, dog, swine, poultry, duck, and turkey). The degree of agreement between these two proportions was estimated by calculating ...
Development of the equine gut microbiota. Shortly after birth the mammalian gut is colonized, by a transient microbiota, highly susceptible to environment and diet, that eventually stabilizes and becomes the resident gut microbiota. In a window of opportunity during the colonization, oral tolerance is established towards resident bacteria. In this study, the development of the equine gut microbiota was investigated in ten foals from parturition until post weaning. We found great differences in the core species of the gut microbiota composition between time-matched samples on Day 7 and 20 post-partum. Between day 20 and Day 50 post-par...
In vitro-produced horse embryos exhibit a very narrow window of acceptable recipient mare uterine synchrony compared with in vivo-derived embryos. In recent years, the number of equine invitro-produced embryos (IVP) has increased markedly; as yet, there are few reports on what constitutes an 'ideal' recipient for an IVP embryo. This study retrospectively investigated the effects of recipient mare oestrous cycle characteristics on the likelihood of pregnancy after transfer of IVP (n=264) and invivo-derived embryos (n=262). IVP embryos tolerated only a narrow window of recipient mare 'synchrony', with transfer on Day 4 after ovulation resulting in a higher likelihood of ongoing pregnancy (69%) than transfer on Days 3, 5 or 6 (53.2%, 41.3% ...
An MRI study of solute transport in the intervertebral disc. Quantitative magnetic resonance imaging was used to determine partition coefficients and characteristic time constants for diffusion of MRI contrast agents in disc tissue. Methods: Twenty-two excised equine intervertebral discs were exposed to a range of contrast agents: six to manganese chloride, eight to Magnevist (gadopentetate dimeglumine) and eight to Gadovist (gadobutrol), and uptake into the disc was quantified in T-weighted images. Results: Diffusion for all contrast agents was approximately 25% faster in the nucleus than in the outer annulus; disc-average time constants ranged from (2...
Warmblood fragile foal syndrome type 1 mutation (PLOD1 c.2032G>A) is not associated with catastrophic breakdown and has a low allele frequency in the Thoroughbred breed. Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Metabolic and Endocrine Disorders in Donkeys. The donkey evolved under harsh and arid environmental conditions, developing unique energy-efficiency traits, with an efficiency to rapidly mobilize fat in situations of increased energy demands or when food is scarce. This evolution has led to an inherent predisposition of donkeys to obesity, dyslipidemias, insulin dysregulation/metabolic syndrome, pituitary pars intermedia dysfunction, and endocrinopathic laminitis. Marked differences have been described in hormone dynamics and testing protocols for the diagnosis of these endocrine and metabolic diseases in donkeys compared with horses, unde...
Clinical Pharmacology in Donkeys and Mules. Donkeys and mules show several pharmacodynamic and pharmacokinetic idiosyncrasies that have to be fully considered by any clinician dealing with these species. Because they possess an increased metabolic rate and cellular water content compared with horses, higher doses (or shorter dosing intervals) are usually recommended for those drugs where pharmacologic studies have been performed. Nonetheless, owing to the lack of species-specific information, this assumption cannot be arbitrarily applied. Thus, when a drug protocol published for horses is extrapolated to a donkey or a mule, a close moni...
A Review of Biomechanical Gait Classification with Reference to Collected Trot, Passage and Piaffe in Dressage Horses. Gaits are typically classified as walking or running based on kinematics, the shape of the vertical ground reaction force (GRF) curve, and the use of inverted pendulum or spring-mass mechanics during the stance phase. The objectives of this review were to describe the biomechanical characteristics that differentiate walking and running gaits, then apply these criteria to classify and compare the enhanced natural gait of collected trot with the artificial gaits of passage and piaffe as performed by highly trained dressage horses. Limb contact and lift off times were used to determine contact se...
Hoof Disorders and Farriery in the Donkey. This article provides a review of hoof anatomy and care in donkeys and mules. Hoof disease is a major cause of poor welfare and mortality globally. Problems associated with hoof disease are discussed in the context of behavior, diet, treatment, and prevention. The most common conditions encountered are discussed, including laminitis, the overgrown unbalanced hoof, white line disease, flexural deformities, and other significant issues. Differences between donkey and horse hoof anatomy are described.
Reference values of hematological and blood biochemical parameters for the Noma horse. The Noma horse is a Japanese breed from the Noma region of Imabari City, Ehime Prefecture. To obtain reference hematological and biochemical values, we performed examinations in 39 clinically healthy, mature Noma horses managed at the Imabari public ranch. Hematological and biochemical results of Noma horses were close to the normal ranges of horses in the U.S.A. The erythrocyte parameters and hepatobiliary enzyme levels in Noma and Kiso horses were lower than those in Japanese racehorses. Noma horses showed higher erythrocyte parameters and triglyceride concentrations and a lower creatinine c...
Comparison of Serum Amyloid A Measurements in Equine Synovial Fluid With Routine Diagnostic Methods to Detect Synovial Infection in a Clinical Environment. Synovial fluid analysis is utilized to diagnose septic synovitis. However, not all cases are clearly and rapidly discernible with the diagnostic tools available in the laboratory. Serum amyloid A (SAA), an acute phase protein, has been shown to be elevated in synovial fluid from inflamed synovial structures. The goal of this study is to describe the correlation between two diagnostic tests measuring equine SAA levels in septic and non-septic synovial structures and to understand the correlation between an elevated SAA result and synovial sepsis. Prospective estimation of sensitivity (Se) and s...
Ten years of the horse reference genome: insights into equine biology, domestication and population dynamics in the post-genome era. The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromer...
Transition to the ovulatory season in mares: An investigation of antral follicle receptor gene expression in vivo. The inability to obtain in vivo samples of antral follicle wall layers without removing the ovaries or sacrificing the animals has limited more in-depth studies on folliculogenesis. In this study, a novel ultrasound-guided follicle wall biopsy (FWB) technique was used to obtain in vivo follicle wall layers and follicular fluid samples of growing antral follicles. The expression of proliferative, hormonal, angiogenic, and pro-/antiapoptotic receptors and proteins in the follicular wall among three follicle classes were compared during the spring transitional anovulatory (SAN) and spring ovulato...
