Analyze Diet

Topic:Neurological Diseases

Neurological diseases in horses encompass a range of disorders affecting the central and peripheral nervous systems. These conditions can arise from various etiologies, including infectious agents, genetic predispositions, trauma, or metabolic imbalances. Common neurological diseases in horses include equine protozoal myeloencephalitis (EPM), equine herpesvirus myeloencephalopathy (EHM), and cervical vertebral stenotic myelopathy (CVSM), also known as wobbler syndrome. Clinical signs associated with these diseases may include ataxia, weakness, altered gait, and changes in behavior or mental status. Diagnosis typically involves a combination of clinical evaluation, imaging techniques, and laboratory testing. This page compiles peer-reviewed research studies and scholarly articles that investigate the pathophysiology, diagnostic approaches, and treatment options for neurological diseases in equine populations.
Genome-wide association study for host genetic factors associated with equine herpesvirus type-1 induced myeloencephalopathy.
Equine veterinary journal    April 6, 2020   Volume 52, Issue 6 794-798 doi: 10.1111/evj.13261
Dunuwille WMB, YousefiMashouf N, Balasuriya UBR, Pusterla N, Bailey E.Equid herpesvirus (EHV-1) infections in horses can lead to equine herpesvirus myeloencephalopathy (EHM), characterised by neurological clinical signs. The sporadic occurrence of the disease in horse herds suggests a host genetic component. A recent study reported an association between the occurrence of EHM and genetic markers on horse chromosome 6 (ECA6). Objective: To investigate the association of EHM with genetic host factors, especially with reference to the association reported for ECA6. Methods: Genome-wide association study (GWAS) was conducted based on 94 horses that had EHV-1 infecti...
Quantitative motor unit action potential analysis of paraspinal muscles, diagnostic imaging and necropsy findings in 36 horses suspected of cervical impairment.
Schweizer Archiv fur Tierheilkunde    April 3, 2020   Volume 162, Issue 4 213-221 doi: 10.17236/sat00252
Graubner C, Bergmann W, Gerber V, Veraa S, Oevermann A, Wijnberg I.Aims: To determine the relation between quantitative electromyography (QEMG) of the cervical ventral serratus muscle, radiographic findings and post-mortem gross and histopathological examination in order to calculate the ability of QEMG to localize the region of cervical compressive neuropathy and myelopathy in horses. Methods: In this clinical, non-randomised, partially blinded study (QEMG and histology), 36 warmblood horses with clinical suspicion of cervical spine disease were examined with QEMG in different segments of the ventral serratus muscle. Results were compared to normative data. ...
Equine-Assisted Intervention to Improve Perceived Value of Everyday Occupations and Quality of Life in People with Lifelong Neurological Disorders: A Prospective Controlled Study.
International journal of environmental research and public health    April 3, 2020   Volume 17, Issue 7 2431 doi: 10.3390/ijerph17072431
Pálsdóttir AM, Gudmundsson M, Grahn P.People with neurological disorders suffer from poor mobility, poor balance, fatigue, isolation and monotonous everyday activities. Studies show that equine-assisted interventions can improve their mobility and balance, but could these kinds of interventions also increase participants' activity repertoire and self-assessed health, and reduce their fatigue? The study was conducted as a prospective, controlled study with three cohorts followed for one year: intervention group ( = 14), control group Passive ( = 29), and control group Active ( = 147). Participants in the study were affected by neur...
Borna disease outbreak with high mortality in an alpaca herd in a previously unreported endemic area in Germany.
Transboundary and emerging diseases    March 29, 2020   doi: 10.1111/tbed.13556
Schulze V, Große R, Fürstenau J, Forth LF, Ebinger A, Richter MT, Tappe D, Mertsch T, Klose K, Schlottau K, Hoffmann B, Höper D, Mundhenk L....Borna disease virus 1 (BoDV-1) is the causative agent of Borna disease, an often fatal neurologic condition of domestic mammals, including New World camelids, in endemic areas in Central Europe. Recently, BoDV-1 gained further attention by the confirmation of fatal zoonotic infections in humans. Although Borna disease and BoDV-1 have been described already over the past decades, comprehensive reports of Borna disease outbreaks in domestic animals employing state-of-the-art diagnostic methods are missing. Here, we report a series of BoDV-1 infections in a herd of 27 alpacas (Vicugna pacos) in t...
First case of fatal equine meningoencephalitis caused by Halicephalobus gingivalis in Mexico.
Veterinary parasitology, regional studies and reports    March 18, 2020   Volume 20 100399 doi: 10.1016/j.vprsr.2020.100399
Avila VA, López-García Y, Hernández-Castro R, Salas-Garrido CG, Ramírez-Lezama J, Calderón-Villa R, Martínez-Chavarría LC.Aberrant nematode larval migration in the CNS of horses is rare but frequently fatal; one of the main etiological agents involved in this illness is Halicephalobus gingivalis. This soil nematode has been associated with several fatal equine meningoencephalitis reports worldwide; however, it had never been diagnosed in horses of Mexico. A 10 year-old Andalusian horse presented dysphagia, fever, weakness, prostration and ataxia; the patient expired during the medical attention. Post mortem examination was performed and no gross alterations were found. Histopathology revealed meningoencephalitis...
Serological survey of Neospora spp. and Besnoitia spp. in horses in Portugal.
Veterinary parasitology, regional studies and reports    February 21, 2020   Volume 20 100391 doi: 10.1016/j.vprsr.2020.100391
Waap H, Volkart de Oliveira U, Nunes T, Gomes J, Gomes T, Bärwald A, Dias Munhoz A, Schares G.Equine neosporosis is regarded to be caused either by Neospora hughesi or Neospora caninum and equine besnoitiosis is caused by Besnoitia bennetti, both of which are apicomplexan parasites. N. caninum is the only known Neospora species in Europe, where equine N. caninum infections have been reported as being associated to abortion and reproductive failure. N. hughesi is prevalent in North America and was predominantly linked to neurological disorders. B. bennetti is considered an emergent disease in donkeys in North America and evidence for B. bennetti infection was recently reported in Europe...
Tetanus in animals. Popoff MR.Tetanus is a neurologic disease of humans and animals characterized by spastic paralysis. Tetanus is caused by tetanus toxin (TeNT) produced by Clostridium tetani, an environmental soilborne, gram-positive, sporulating bacterium. The disease most often results from wound contamination by soil containing C. tetani spores. Horses, sheep, and humans are highly sensitive to TeNT, whereas cattle, dogs, and cats are more resistant. The diagnosis of tetanus is mainly based on the characteristic clinical signs. Identification of C. tetani at the wound site is often difficult.
Cerebral Computed Tomography Scan Demonstrating Ischemic Stroke in a Filly After Intravenous Antibiotic Administration.
Journal of equine veterinary science    February 14, 2020   Volume 88 102953 doi: 10.1016/j.jevs.2020.102953
Saliou G, d'Ablon X, Théaudin M, Saliou T, Bourassi S.Performing a brain computerized tomography scan (CT scan) on a foal requires specific equipment and anesthesia for large animals. However, the information obtained may demonstrate lesions responsible for the neurological deficits. Especially, CT scan findings may help to understand a mechanism of cerebral ischemia. Indeed, categories of cerebral ischemia are divided in three types: territorial infarctions (downstream of the territory of an artery), watershed infarctions (slow-flow at the junction of two arterial territories), and lacunar infarctions (small-vessel occlusions). Hypersensitivity ...
Accuracy of transcranial magnetic stimulation and a Bayesian latent class model for diagnosis of spinal cord dysfunction in horses.
Journal of veterinary internal medicine    February 6, 2020   Volume 34, Issue 2 964-971 doi: 10.1111/jvim.15699
Rijckaert J, Raes E, Buczinski S, Dumoulin M, Deprez P, Van Ham L, van Loon G, Pardon B.Spinal cord dysfunction/compression and ataxia are common in horses. Presumptive diagnosis is most commonly based on neurological examination and cervical radiography, but the interest into the diagnostic value of transcranial magnetic stimulation (TMS) with recording of magnetic motor evoked potentials has increased. The problem for the evaluation of diagnostic tests for spinal cord dysfunction is the absence of a gold standard in the living animal. Objective: To compare diagnostic accuracy of TMS, cervical radiography, and neurological examination. Methods: One hundred seventy-four horses ad...
Comparison of 2 collection methods for cerebrospinal fluid analysis from standing, sedate adult horses.
Journal of veterinary internal medicine    January 24, 2020   Volume 34, Issue 2 972-978 doi: 10.1111/jvim.15702
Chidlow H, Giguère S, Camus M, Wells B, Howerth E, Berghaus R, McConachie Beasley E.Cerebrospinal fluid (CSF) analysis is an important component of the evaluation of horses with neurologic disease. Lumbosacral (LS) centesis is routine, but CSF is also collected from the space between the first and second cervical vertebrae (C1-C2). Objective: To compare collection times, CSF cytology results, and equine protozoal myelitis (EPM) titers of CSF collected from the C1-C2 and LS sites. Methods: Fifteen university-owned adult horses with no evidence of neurologic disease, and 9 horses with signs of neurologic disease: 3 university-owned and 6 client-owned. Methods: Prospective study...
Equine Herpesvirus-I Infection in Horses: Recent Updates on its Pathogenicity, Vaccination, and Preventive Management Strategies.
Journal of equine veterinary science    January 11, 2020   Volume 87 102923 doi: 10.1016/j.jevs.2020.102923
Khusro A, Aarti C, Rivas-Caceres RR, Barbabosa-Pliego A.Equine herpesvirus-1 (EHV-1) is one of the most common and ubiquitous viral pathogens infecting equines, particularly horses worldwide. The EHV-1 is known to induce not only humoral but also cellular immune responses in horses. Respiratory distress, abortion in pregnant mares, neurological disorders, and neonatal foal deaths represent EHV-1 infection. Despite the limited success of inactivated, subunit, live, and DNA vaccines, over the past few decades, vaccination remains the prime preventive option to combat EHV-1 infection in horses. However, current vaccines lack the potentiality to protec...
[Physiotherapy interventions through hippotherapy in the treatment of cerebral palsy. A literature review].
Rehabilitacion    January 10, 2020   Volume 54, Issue 2 96-106 doi: 10.1016/j.rh.2019.11.003
Mendizábal Alonso P.Cerebral palsy is produced by nonprogressive injury to the developing brain. This lesion produces life-long motor impairments, disturbances in perception, speech, communication, cognition and competence. Physiotherapy is an important part of treatment, and may include hippotherapy, which uses the movement of the horse to stimulate the sensorial, neuromotor and cognitive systems to obtain functional results. Methods: We performed a literature search using distinct databases and the following Keywords: "hippotherapy"; "cerebral palsy"; "children"; "treatment" and "physiotherapy". After applicati...
Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.
Genes    January 10, 2020   Volume 11, Issue 1 doi: 10.3390/genes11010082
Hales EN, Esparza C, Peng S, Dahlgren AR, Peterson JM, Miller AD, Finno CJ.Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role ...
First molecular characterization of Sarcocystis neurona causing meningoencephalitis in a domestic cat in Brazil.
Parasitology research    January 4, 2020   Volume 119, Issue 2 675-682 doi: 10.1007/s00436-019-06570-w
Hammerschmitt ME, Henker LC, Lichtler J, da Costa FVA, Soares RM, Llano HAB, Pavarini SP.Sarcocystis neurona is the main agent associated with equine protozoal myeloencephalitis (EPM). Apart from horses, S. neurona has been occasionally described causing neurologic disease in several other terrestrial animals as well as mortality in marine mammals. Herein, we describe the clinical, pathological, and molecular findings of a fatal case of S. neurona-associated meningoencephalitis in a domestic cat. The causing agent was analyzed by multilocus genotyping, confirming the presence of S. neurona DNA in the tissue samples of the affected animal. Significant molecular differences were fou...
Neurosurgical management of head injuries incurred during sports: a single centre experience.
British journal of neurosurgery    January 3, 2020   Volume 34, Issue 2 119-122 doi: 10.1080/02688697.2019.1708267
Hall S, McElligott S, Sadek AR, Griffith C, Waters R, Nader-Sepahi A. Accidents during sporting activities are a common cause of head injury, particularly in children and young adults. Whilst most sporting head injuries are minor, there remains a proportion which is associated with high morbidity and mortality. The epidemiology of sports associated head injuries is variable based on geographical region so the aim of this study was to review the management and outcomes of sporting head injuries managed by a single neurosurgical unit in the South of England. A retrospective review of the Trauma Audit and Research Network database was conducted for all patients ad...
Biofluid Markers of Equine Neurological Disorders Reviewed From Human Perspectives.
Journal of equine veterinary science    December 30, 2019   Volume 86 102907 doi: 10.1016/j.jevs.2019.102907
Mayaki AM, Abdul Razak IS, Noraniza MA, Mazlina M, Rasedee A.Neurological disorders (NDs) are often fatal to horses. Thus, symptoms of equine NDs commonly indicate euthanasia. Current diagnostic approaches for equine NDs is based on clinical signs, differential diagnoses, analysis of cerebrospinal fluid (CSF), assessment of histopathological lesions, and imaging. However, advances in biofluid biomarkers in the diagnosis of human neurological diseases can potentially be applied to equine NDs. In this review, we described the established human blood and CSF neurobiomarkers that could potentially be used to diagnose equine NDs.
The First Report of Genetic and Structural Diversities in the SPRN Gene in the Horse, an Animal Resistant to Prion Disease.
Genes    December 28, 2019   Volume 11, Issue 1 39 doi: 10.3390/genes11010039
Won SY, Kim YC, Kim SK, Jeong BH.Prion diseases are fatal neurodegenerative diseases and are characterized by the accumulation of abnormal prion protein (PrP) in the brain. During the outbreak of the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, prion diseases in several species were reported; however, horse prion disease has not been reported thus far. In previous studies, the shadow of prion protein (Sho) has contributed to an acceleration of conversion from normal prion protein (PrP) to PrP, and the shadow of prion protein gene () polymorphisms have been significantly associated with the susceptibi...
Viral Equine Encephalitis, a Growing Threat to the Horse Population in Europe?
Viruses    December 24, 2019   Volume 12, Issue 1 doi: 10.3390/v12010023
Lecollinet S, Pronost S, Coulpier M, Beck C, Gonzalez G, Leblond A, Tritz P.Neurological disorders represent an important sanitary and economic threat for the equine industry worldwide. Among nervous diseases, viral encephalitis is of growing concern, due to the emergence of arboviruses and to the high contagiosity of herpesvirus-infected horses. The nature, severity and duration of the clinical signs could be different depending on the etiological agent and its virulence. However, definite diagnosis generally requires the implementation of combinations of direct and/or indirect screening assays in specialized laboratories. The equine practitioner, involved in a missi...
Emergence of West Nile virus lineage 2 in Europe: Characteristics of the first seven cases of West Nile neuroinvasive disease in horses in Austria.
Transboundary and emerging diseases    December 24, 2019   Volume 67, Issue 3 1189-1197 doi: 10.1111/tbed.13452
de Heus P, Kolodziejek J, Camp JV, Dimmel K, Bagó Z, Hubálek Z, van den Hoven R, Cavalleri JV, Nowotny N.We report details of the first seven equine cases of confirmed West Nile neuroinvasive disease in Austria. The cases presented during summer and autumn of 2016 (n = 2), 2017 (n = 3) and 2018 (n = 2). All horses showed gait abnormalities and 6 of 7 horses exhibited fasciculations and/or tremors, and we provide video recordings of these. Three horses also showed cranial nerve involvement. Following rapid improvement, three horses were discharged. Four horses were euthanized due to the severity of clinical signs and subjected to neuropathological examination. West Nile virus (WNV) lineage 2...
Retrospective evaluation of the association between hyponatremia and neurological dysfunction in hospitalized foals (2012-2016): 109 cases.
Journal of veterinary emergency and critical care (San Antonio, Tex. : 2001)    December 17, 2019   Volume 30, Issue 1 66-73 doi: 10.1111/vec.12906
Dunkel B, Dodson F, Chang YM, Slovis NM.Hyponatremia and rapid correction of hyponatremia can lead to neurological abnormalities. The objective of the study was to determine whether plasma sodium concentrations (Na ) and speed of correction of hyponatremia are significantly associated with neurological abnormalities in foals. Methods: Retrospective cohort study 2012 to 2016. Methods: Equine hospital. Methods: One hundred and nine foals <6 months old with hyponatremia (Na concentration ≤125 mmol/L). Methods: Case records were reviewed for any foal with hyponatremia. Clinicopathological findings, presence or absence of neurologi...
Serological evidence of arboviruses and coccidia infecting horses in the Amazonian region of Brazil.
PloS one    December 12, 2019   Volume 14, Issue 12 e0225895 doi: 10.1371/journal.pone.0225895
Gomes FA, Jansen AM, Machado RZ, Jesus Pena HF, Fumagalli MJ, Silva A, Alves BF, Roque ALR, Moraes Figueiredo LT.Arboviruses and protozoans can cause neurologic disorders in horses. In Brazilian Amazon, several horses presenting signs compatible with disorders caused by these infectious agents have been observed. To contribute to the knowledge of this epidemiological picture, we sought to construct a serological diagnostic panel for neurotrophic infectious agents in local horses. A total of 213 blood samples from horses were collected from 29 farms in three municipalities. Samples were evaluated and considered positive when they met the following criteria: titers ≥ 1:80 with the indirect fluorescent an...
Efficacy of FDA-Approved Anti-Inflammatory Drugs Against Venezuelan Equine Encephalitis Virus Infection.
Viruses    December 12, 2019   Volume 11, Issue 12 1151 doi: 10.3390/v11121151
Risner K, Ahmed A, Bakovic A, Kortchak S, Bhalla N, Narayanan A.Venezuelan equine encephalitis virus (VEEV) is a category B select agent pathogen that can be aerosolized. Infections in murine models and humans can advance to an encephalitic phenotype which may result in long-term neurological complications or death. No specific FDA-approved treatments or vaccines are available for the treatment or prevention of VEEV infection. Neurotropic viral infections have two damaging components: neuronal death caused by viral replication, and damage from the subsequent inflammatory response. Reducing the level of inflammation may lessen neurological tissue damage tha...
Fungal and chemical diversity in hay and wrapped haylage for equine feed.
Mycotoxin research    November 27, 2019   Volume 36, Issue 2 159-172 doi: 10.1007/s12550-019-00377-5
Andersen B, Phippen C, Frisvad JC, Emery S, Eustace RA.The presence of fungi and mycotoxins in silage (fermented maize) for cattle and other ruminants have been studied extensively compared to wrapped haylage (fermented grass) for horses and other monogastric animals. The purpose of this work was to examine the fungal diversity of wrapped haylage and conventional hay and to analyse the forage sample for fungal metabolites. Faeces samples were also analysed to study the fate of fungi and metabolites. Fungal diversity of the samples was determined by direct plating on DG18, V8 and MEA and chemical analyses were done using LC-MS/MS. The results show ...
Species-specific consequences of an E40K missense mutation in superoxide dismutase 1 (SOD1).
FASEB journal : official publication of the Federation of American Societies for Experimental Biology    November 25, 2019   Volume 34, Issue 1 458-473 doi: 10.1096/fj.201901455R
Draper ACE, Wilson Z, Maile C, Faccenda D, Campanella M, Piercy RJ.A glutamic acid to lysine (E40K) residue substitution in superoxide dismutase 1 (SOD1) is associated with canine degenerative myelopathy: the only naturally occurring large animal model of amyotrophic lateral sclerosis (ALS). The E40 residue is highly conserved across mammals, except the horse, which naturally carries the (dog mutant) K40 residue. Here we hypothesized that in vitro expression of mutant dog SOD1 would recapitulate features of human ALS (ie, SOD1 protein aggregation, reduced cell viability, perturbations in mitochondrial morphology and membrane potential, reduced ATP production,...
Equine herpesvirus-1 genotype did not significantly affect clinical signs and disease outcome in 65 horses diagnosed with equine herpesvirus-1 myeloencephalopathy.
Veterinary journal (London, England : 1997)    November 13, 2019   Volume 255 105407 doi: 10.1016/j.tvjl.2019.105407
Pusterla N, Hatch K, Crossley B, Wademan C, Barnum S, Flynn K.The objective of this study was to determine if the genotype of equine herpesvirus-1 (EHV-1) impacted clinical disease and outcome of horses with laboratory confirmed equine herpesvirus myeloencephalopathy (EHM). Medical records from 65 horses diagnosed with EHM from 2011 to 2019 were reviewed for signalment, presence and severity of clinical signs (lethargy, fever, ataxia, urinary incontinence) and outcome. Horses were further grouped based on the EHV-1 genotype into neuropathic (D) or non-neuropathic (N) EHV-1 infection. Between the two EHV-1 genotype groups, age and sex distributions were s...
Cauda equina syndrome in an ovarian malignant-mixed müllerian tumor with leptomeningeal spread.
Clinical case reports    October 22, 2019   Volume 7, Issue 12 2341-2345 doi: 10.1002/ccr3.2472
Bernstock JD, Ostby S, Fox B, Sotoudeh H, Janssen A, Kang YJ, Chen J, Prattipati V, Elsayed G, Chagoya G, Yamashita D, Friedman GK, Nabors B, Huh WK....Leptomeningeal metastasis is extremely rare in patients with ovarian cancer, but should be considered in patients presenting with neurologic deficits such as cauda equine syndrome. Given its poor prognosis and lack of data currently on management, additional studies are needed to optimize treatment regimens and improve outcomes.
Ganglioglioma of the Right Cerebrothalamus in a 7-Year-Old Quarter Horse Cross Gelding.
Frontiers in veterinary science    October 22, 2019   Volume 6 356 doi: 10.3389/fvets.2019.00356
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Viruses in Horses with Neurologic and Respiratory Diseases.
Viruses    October 14, 2019   Volume 11, Issue 10 942 doi: 10.3390/v11100942
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Assessing pathological changes within the nucleus ambiguus of horses with recurrent laryngeal neuropathy: An extreme, length-dependent axonopathy.
Muscle & nerve    October 9, 2019   Volume 60, Issue 6 762-768 doi: 10.1002/mus.26699
Draper ACE, Cahalan SD, Goodwin D, Perkins J, Piercy RJ.Equine recurrent laryngeal neuropathy (RLN) is a naturally occurring model of length-dependent axonopathy characterized by asymmetrical degeneration of recurrent laryngeal nerve axons (RLn). Distal RLn degeneration is marked, but it is unclear whether degeneration extends to include cell bodies (consistent with a neuronopathy). With examiners blinded to RLN severity, brainstem location, and side, we examined correlations between RLN severity (assessed using left distal RLn myelinated axon count) and histopathological features (including chromatolysis and glial responses) in the nucleus ambiguu...
1 7 8 9 10 11 53