Neurological diseases in horses encompass a range of disorders affecting the central and peripheral nervous systems. These conditions can arise from various etiologies, including infectious agents, genetic predispositions, trauma, or metabolic imbalances. Common neurological diseases in horses include equine protozoal myeloencephalitis (EPM), equine herpesvirus myeloencephalopathy (EHM), and cervical vertebral stenotic myelopathy (CVSM), also known as wobbler syndrome. Clinical signs associated with these diseases may include ataxia, weakness, altered gait, and changes in behavior or mental status. Diagnosis typically involves a combination of clinical evaluation, imaging techniques, and laboratory testing. This page compiles peer-reviewed research studies and scholarly articles that investigate the pathophysiology, diagnostic approaches, and treatment options for neurological diseases in equine populations.
Dunuwille WMB, YousefiMashouf N, Balasuriya UBR, Pusterla N, Bailey E.Equid herpesvirus (EHV-1) infections in horses can lead to equine herpesvirus myeloencephalopathy (EHM), characterised by neurological clinical signs. The sporadic occurrence of the disease in horse herds suggests a host genetic component. A recent study reported an association between the occurrence of EHM and genetic markers on horse chromosome 6 (ECA6). Objective: To investigate the association of EHM with genetic host factors, especially with reference to the association reported for ECA6. Methods: Genome-wide association study (GWAS) was conducted based on 94 horses that had EHV-1 infecti...
Graubner C, Bergmann W, Gerber V, Veraa S, Oevermann A, Wijnberg I.Aims: To determine the relation between quantitative electromyography (QEMG) of the cervical ventral serratus muscle, radiographic findings and post-mortem gross and histopathological examination in order to calculate the ability of QEMG to localize the region of cervical compressive neuropathy and myelopathy in horses. Methods: In this clinical, non-randomised, partially blinded study (QEMG and histology), 36 warmblood horses with clinical suspicion of cervical spine disease were examined with QEMG in different segments of the ventral serratus muscle. Results were compared to normative data. ...
Pálsdóttir AM, Gudmundsson M, Grahn P.People with neurological disorders suffer from poor mobility, poor balance, fatigue, isolation and monotonous everyday activities. Studies show that equine-assisted interventions can improve their mobility and balance, but could these kinds of interventions also increase participants' activity repertoire and self-assessed health, and reduce their fatigue? The study was conducted as a prospective, controlled study with three cohorts followed for one year: intervention group ( = 14), control group Passive ( = 29), and control group Active ( = 147). Participants in the study were affected by neur...
Schulze V, Große R, Fürstenau J, Forth LF, Ebinger A, Richter MT, Tappe D, Mertsch T, Klose K, Schlottau K, Hoffmann B, Höper D, Mundhenk L....Borna disease virus 1 (BoDV-1) is the causative agent of Borna disease, an often fatal neurologic condition of domestic mammals, including New World camelids, in endemic areas in Central Europe. Recently, BoDV-1 gained further attention by the confirmation of fatal zoonotic infections in humans. Although Borna disease and BoDV-1 have been described already over the past decades, comprehensive reports of Borna disease outbreaks in domestic animals employing state-of-the-art diagnostic methods are missing. Here, we report a series of BoDV-1 infections in a herd of 27 alpacas (Vicugna pacos) in t...
Avila VA, López-García Y, Hernández-Castro R, Salas-Garrido CG, Ramírez-Lezama J, Calderón-Villa R, Martínez-Chavarría LC.Aberrant nematode larval migration in the CNS of horses is rare but frequently fatal; one of the main etiological agents involved in this illness is Halicephalobus gingivalis. This soil nematode has been associated with several fatal equine meningoencephalitis reports worldwide; however, it had never been diagnosed in horses of Mexico. A 10 year-old Andalusian horse presented dysphagia, fever, weakness, prostration and ataxia; the patient expired during the medical attention. Post mortem examination was performed and no gross alterations were found. Histopathology revealed meningoencephalitis...
Waap H, Volkart de Oliveira U, Nunes T, Gomes J, Gomes T, Bärwald A, Dias Munhoz A, Schares G.Equine neosporosis is regarded to be caused either by Neospora hughesi or Neospora caninum and equine besnoitiosis is caused by Besnoitia bennetti, both of which are apicomplexan parasites. N. caninum is the only known Neospora species in Europe, where equine N. caninum infections have been reported as being associated to abortion and reproductive failure. N. hughesi is prevalent in North America and was predominantly linked to neurological disorders. B. bennetti is considered an emergent disease in donkeys in North America and evidence for B. bennetti infection was recently reported in Europe...
Popoff MR.Tetanus is a neurologic disease of humans and animals characterized by spastic paralysis. Tetanus is caused by tetanus toxin (TeNT) produced by Clostridium tetani, an environmental soilborne, gram-positive, sporulating bacterium. The disease most often results from wound contamination by soil containing C. tetani spores. Horses, sheep, and humans are highly sensitive to TeNT, whereas cattle, dogs, and cats are more resistant. The diagnosis of tetanus is mainly based on the characteristic clinical signs. Identification of C. tetani at the wound site is often difficult.
Saliou G, d'Ablon X, Théaudin M, Saliou T, Bourassi S.Performing a brain computerized tomography scan (CT scan) on a foal requires specific equipment and anesthesia for large animals. However, the information obtained may demonstrate lesions responsible for the neurological deficits. Especially, CT scan findings may help to understand a mechanism of cerebral ischemia. Indeed, categories of cerebral ischemia are divided in three types: territorial infarctions (downstream of the territory of an artery), watershed infarctions (slow-flow at the junction of two arterial territories), and lacunar infarctions (small-vessel occlusions). Hypersensitivity ...
Rijckaert J, Raes E, Buczinski S, Dumoulin M, Deprez P, Van Ham L, van Loon G, Pardon B.Spinal cord dysfunction/compression and ataxia are common in horses. Presumptive diagnosis is most commonly based on neurological examination and cervical radiography, but the interest into the diagnostic value of transcranial magnetic stimulation (TMS) with recording of magnetic motor evoked potentials has increased. The problem for the evaluation of diagnostic tests for spinal cord dysfunction is the absence of a gold standard in the living animal. Objective: To compare diagnostic accuracy of TMS, cervical radiography, and neurological examination. Methods: One hundred seventy-four horses ad...
Chidlow H, Giguère S, Camus M, Wells B, Howerth E, Berghaus R, McConachie Beasley E.Cerebrospinal fluid (CSF) analysis is an important component of the evaluation of horses with neurologic disease. Lumbosacral (LS) centesis is routine, but CSF is also collected from the space between the first and second cervical vertebrae (C1-C2). Objective: To compare collection times, CSF cytology results, and equine protozoal myelitis (EPM) titers of CSF collected from the C1-C2 and LS sites. Methods: Fifteen university-owned adult horses with no evidence of neurologic disease, and 9 horses with signs of neurologic disease: 3 university-owned and 6 client-owned. Methods: Prospective study...
Khusro A, Aarti C, Rivas-Caceres RR, Barbabosa-Pliego A.Equine herpesvirus-1 (EHV-1) is one of the most common and ubiquitous viral pathogens infecting equines, particularly horses worldwide. The EHV-1 is known to induce not only humoral but also cellular immune responses in horses. Respiratory distress, abortion in pregnant mares, neurological disorders, and neonatal foal deaths represent EHV-1 infection. Despite the limited success of inactivated, subunit, live, and DNA vaccines, over the past few decades, vaccination remains the prime preventive option to combat EHV-1 infection in horses. However, current vaccines lack the potentiality to protec...
Mendizábal Alonso P.Cerebral palsy is produced by nonprogressive injury to the developing brain. This lesion produces life-long motor impairments, disturbances in perception, speech, communication, cognition and competence. Physiotherapy is an important part of treatment, and may include hippotherapy, which uses the movement of the horse to stimulate the sensorial, neuromotor and cognitive systems to obtain functional results. Methods: We performed a literature search using distinct databases and the following Keywords: "hippotherapy"; "cerebral palsy"; "children"; "treatment" and "physiotherapy". After applicati...
Hales EN, Esparza C, Peng S, Dahlgren AR, Peterson JM, Miller AD, Finno CJ.Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role ...
Hammerschmitt ME, Henker LC, Lichtler J, da Costa FVA, Soares RM, Llano HAB, Pavarini SP.Sarcocystis neurona is the main agent associated with equine protozoal myeloencephalitis (EPM). Apart from horses, S. neurona has been occasionally described causing neurologic disease in several other terrestrial animals as well as mortality in marine mammals. Herein, we describe the clinical, pathological, and molecular findings of a fatal case of S. neurona-associated meningoencephalitis in a domestic cat. The causing agent was analyzed by multilocus genotyping, confirming the presence of S. neurona DNA in the tissue samples of the affected animal. Significant molecular differences were fou...
Hall S, McElligott S, Sadek AR, Griffith C, Waters R, Nader-Sepahi A. Accidents during sporting activities are a common cause of head injury, particularly in children and young adults. Whilst most sporting head injuries are minor, there remains a proportion which is associated with high morbidity and mortality. The epidemiology of sports associated head injuries is variable based on geographical region so the aim of this study was to review the management and outcomes of sporting head injuries managed by a single neurosurgical unit in the South of England. A retrospective review of the Trauma Audit and Research Network database was conducted for all patients ad...
Mayaki AM, Abdul Razak IS, Noraniza MA, Mazlina M, Rasedee A.Neurological disorders (NDs) are often fatal to horses. Thus, symptoms of equine NDs commonly indicate euthanasia. Current diagnostic approaches for equine NDs is based on clinical signs, differential diagnoses, analysis of cerebrospinal fluid (CSF), assessment of histopathological lesions, and imaging. However, advances in biofluid biomarkers in the diagnosis of human neurological diseases can potentially be applied to equine NDs. In this review, we described the established human blood and CSF neurobiomarkers that could potentially be used to diagnose equine NDs.
Won SY, Kim YC, Kim SK, Jeong BH.Prion diseases are fatal neurodegenerative diseases and are characterized by the accumulation of abnormal prion protein (PrP) in the brain. During the outbreak of the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, prion diseases in several species were reported; however, horse prion disease has not been reported thus far. In previous studies, the shadow of prion protein (Sho) has contributed to an acceleration of conversion from normal prion protein (PrP) to PrP, and the shadow of prion protein gene () polymorphisms have been significantly associated with the susceptibi...
Lecollinet S, Pronost S, Coulpier M, Beck C, Gonzalez G, Leblond A, Tritz P.Neurological disorders represent an important sanitary and economic threat for the equine industry worldwide. Among nervous diseases, viral encephalitis is of growing concern, due to the emergence of arboviruses and to the high contagiosity of herpesvirus-infected horses. The nature, severity and duration of the clinical signs could be different depending on the etiological agent and its virulence. However, definite diagnosis generally requires the implementation of combinations of direct and/or indirect screening assays in specialized laboratories. The equine practitioner, involved in a missi...
de Heus P, Kolodziejek J, Camp JV, Dimmel K, Bagó Z, Hubálek Z, van den Hoven R, Cavalleri JV, Nowotny N.We report details of the first seven equine cases of confirmed West Nile neuroinvasive disease in Austria. The cases presented during summer and autumn of 2016 (n = 2), 2017 (n = 3) and 2018 (n = 2). All horses showed gait abnormalities and 6 of 7 horses exhibited fasciculations and/or tremors, and we provide video recordings of these. Three horses also showed cranial nerve involvement. Following rapid improvement, three horses were discharged. Four horses were euthanized due to the severity of clinical signs and subjected to neuropathological examination. West Nile virus (WNV) lineage 2...
Dunkel B, Dodson F, Chang YM, Slovis NM.Hyponatremia and rapid correction of hyponatremia can lead to neurological abnormalities. The objective of the study was to determine whether plasma sodium concentrations (Na ) and speed of correction of hyponatremia are significantly associated with neurological abnormalities in foals. Methods: Retrospective cohort study 2012 to 2016. Methods: Equine hospital. Methods: One hundred and nine foals <6 months old with hyponatremia (Na concentration ≤125 mmol/L). Methods: Case records were reviewed for any foal with hyponatremia. Clinicopathological findings, presence or absence of neurologi...
Gomes FA, Jansen AM, Machado RZ, Jesus Pena HF, Fumagalli MJ, Silva A, Alves BF, Roque ALR, Moraes Figueiredo LT.Arboviruses and protozoans can cause neurologic disorders in horses. In Brazilian Amazon, several horses presenting signs compatible with disorders caused by these infectious agents have been observed. To contribute to the knowledge of this epidemiological picture, we sought to construct a serological diagnostic panel for neurotrophic infectious agents in local horses. A total of 213 blood samples from horses were collected from 29 farms in three municipalities. Samples were evaluated and considered positive when they met the following criteria: titers ≥ 1:80 with the indirect fluorescent an...
Risner K, Ahmed A, Bakovic A, Kortchak S, Bhalla N, Narayanan A.Venezuelan equine encephalitis virus (VEEV) is a category B select agent pathogen that can be aerosolized. Infections in murine models and humans can advance to an encephalitic phenotype which may result in long-term neurological complications or death. No specific FDA-approved treatments or vaccines are available for the treatment or prevention of VEEV infection. Neurotropic viral infections have two damaging components: neuronal death caused by viral replication, and damage from the subsequent inflammatory response. Reducing the level of inflammation may lessen neurological tissue damage tha...
Andersen B, Phippen C, Frisvad JC, Emery S, Eustace RA.The presence of fungi and mycotoxins in silage (fermented maize) for cattle and other ruminants have been studied extensively compared to wrapped haylage (fermented grass) for horses and other monogastric animals. The purpose of this work was to examine the fungal diversity of wrapped haylage and conventional hay and to analyse the forage sample for fungal metabolites. Faeces samples were also analysed to study the fate of fungi and metabolites. Fungal diversity of the samples was determined by direct plating on DG18, V8 and MEA and chemical analyses were done using LC-MS/MS. The results show ...
Draper ACE, Wilson Z, Maile C, Faccenda D, Campanella M, Piercy RJ.A glutamic acid to lysine (E40K) residue substitution in superoxide dismutase 1 (SOD1) is associated with canine degenerative myelopathy: the only naturally occurring large animal model of amyotrophic lateral sclerosis (ALS). The E40 residue is highly conserved across mammals, except the horse, which naturally carries the (dog mutant) K40 residue. Here we hypothesized that in vitro expression of mutant dog SOD1 would recapitulate features of human ALS (ie, SOD1 protein aggregation, reduced cell viability, perturbations in mitochondrial morphology and membrane potential, reduced ATP production,...
Pusterla N, Hatch K, Crossley B, Wademan C, Barnum S, Flynn K.The objective of this study was to determine if the genotype of equine herpesvirus-1 (EHV-1) impacted clinical disease and outcome of horses with laboratory confirmed equine herpesvirus myeloencephalopathy (EHM). Medical records from 65 horses diagnosed with EHM from 2011 to 2019 were reviewed for signalment, presence and severity of clinical signs (lethargy, fever, ataxia, urinary incontinence) and outcome. Horses were further grouped based on the EHV-1 genotype into neuropathic (D) or non-neuropathic (N) EHV-1 infection. Between the two EHV-1 genotype groups, age and sex distributions were s...
Bernstock JD, Ostby S, Fox B, Sotoudeh H, Janssen A, Kang YJ, Chen J, Prattipati V, Elsayed G, Chagoya G, Yamashita D, Friedman GK, Nabors B, Huh WK....Leptomeningeal metastasis is extremely rare in patients with ovarian cancer, but should be considered in patients presenting with neurologic deficits such as cauda equine syndrome. Given its poor prognosis and lack of data currently on management, additional studies are needed to optimize treatment regimens and improve outcomes.
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Draper ACE, Cahalan SD, Goodwin D, Perkins J, Piercy RJ.Equine recurrent laryngeal neuropathy (RLN) is a naturally occurring model of length-dependent axonopathy characterized by asymmetrical degeneration of recurrent laryngeal nerve axons (RLn). Distal RLn degeneration is marked, but it is unclear whether degeneration extends to include cell bodies (consistent with a neuronopathy). With examiners blinded to RLN severity, brainstem location, and side, we examined correlations between RLN severity (assessed using left distal RLn myelinated axon count) and histopathological features (including chromatolysis and glial responses) in the nucleus ambiguu...
Smith GW, Constable PD, Foreman JH, Eppley RM, Waggoner AL, Tumbleson ME, Haschek WM.To determine whether cardiovascular dysfunction is evident in horses with leukoencephalomalacia experimentally induced by administration of fumonisin B1. Methods: 11 healthy horses of various breeds (body weight, 252 to 367 kg). Methods: Horses were randomly assigned to 3 groups and administered fumonisin B1 daily. Horses received IV injections of 0 (control horses; n = 4), 0.01 (3), or 0.20 mg (4) of fumonisin B1/kg for 7 to 28 days. Horses were examined daily for evidence of neurologic disease. When neurologic signs consistent with leukoencephalomalacia were evident, horses were anesthetized...
Tyler CM, Davis RE, Begg AP, Hutchins DR, Hodgson DR.Case records of 450 horses with signs of neurological disease are reviewed. One hundred and nineteen horses with neurological disease due to trauma were examined, of which 60 were due to spinal cord trauma, 47 to brain or cranial nerve trauma and 12 to peripheral nerve trauma. Cervical vertebral fractures/trauma were the most common injury. Basisphenoid/basioccipital bone fractures were the most common form of cranial trauma and facial nerve paralysis the most common cranial nerve injury. Eighty-nine horses with neurological disease due to malformation were examined. Cervical vertebral malform...
Stierstorfer B, Eichhorn W, Schmahl W, Brandmüller C, Kaaden OR, Neubauer A.An outbreak of neurological disease occurred in a well-managed riding school. Ataxia and paresis were observed in several horses, five of which became recumbent and were euthanized. Post-mortem analysis revealed scattered haemorrhages along the spinal cord, that were reflected by multiple haemorrhagic foci on formalin-fixed sections, with the thoracic and lumbar segments being the most affected. Pathohistologically, perivascular mononuclear cuffing and axonal swelling, especially in the white matter, were evident. Parallel to the course of disease, alterations in myelin sheets and activation o...
Fletcher J, Davies PT, Lewis T, Campbell MJ.Jockeys accept bony fractures and soft tissue injuries as occupational hazards. An average National Hunt jockey falls once in ten races with an injury rate of 4.25%. Head injury is a common cause of morbidity and the benefit of helmets is well recognized. Neck injuries are also common and usually musculoskeletal. Although rare, trauma to the neck arteries may go unnoticed yet have catastrophic consequences. Internal tears can allow arterial blood to dissect the layers of the arterial wall and obstruct the lumen. Severe obstruction may lead to cerebral ischaemia and infarction. An appreciation ...
Ranjithkumar M, Saravanan BC, Yadav SC, Kumar R, Singh R, Dey S.Trypanosoma evansi infection typically produces wasting disease, but it can also develop into a neurological or meningoencephalitis form in equids. Trypanosomiasis in horses was treated with quinapyramine sulfate, and all the 14 infected animals were recovered clinically. After clinical recovery, four animals developed a neurological form of the disease at various intervals. Two of these animals treated with diminazene aceturate recovered temporarily. Repeated attempts failed to find the parasite in the blood or the cerebrospinal fluid (CSF), but all of the animals were positive in enzyme-link...
MacKay RJ, Granstrom DE, Saville WJ, Reed SM.Recent advances in the understanding of the parasite life cycle, epidemiology, clinical signs, diagnosis, treatment, and prevention of EPM are reviewed. The NAHMS Equine '98 study and a controlled retrospective study from The Ohio State University College of Veterinary Medicine identified a number of risk factors associated with development of the disease. The national annual incidence of EPM was 1% or less depending on the primary use of the animals. Increased disease risk was associated with age (1-5 and > 13 years of age), season (lowest in winter months and increasing with ambient tempe...
Ciota AT.Eastern equine encephalitis virus (EEEV; Togaviridae, Alphavirus) is an arthropod-borne virus (arbovirus) primarily maintained in an enzootic cycle between Culiseta melanura (Coquillett) and passerine birds. EEEV, which has the highest reported case- fatality rate among arbovirus in the Americas, is responsible for sporadic outbreaks in the Eastern and Midwest United States. Infection is associated with severe neurologic disease and mortality in horses, humans, and other vertebrate hosts. Here, we review what is known about EEEV taxonomy, functional genomics, and evolution, and identify gaps i...
Williams JH, van Niekerk S, Human S, van Wilpe E, Venter M.Since 2007, West Nile virus (WNV) has been reported in South African horses, causing severe neurological signs. All cases were of lineage 2, except for one case that clustered with lineage 1 viruses. In the present study, gross and microscopic lesions of six South African lineage 2-infected horses and the one lineage 1 case are described. Diagnoses were confirmed by real-time reverse-transcriptase polymerase chain reaction (RT-PCR) of central nervous system (CNS) tissue and one by RT-PCR of a brain virus isolate. The CNS of all cases was negative by RT-PCR or immunohistochemistry (IHC) for Afr...
Kovacić S, Pepeljnjak S, Petrinec Z, Klarić MS.For years scientists have suspected that the environment plays a role in neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and multiple sclerosis. Mycotoxin fumonisin B1 (FB1) is produced by several Fusarium species, mainly by Fusarium verticilioides, which is one of the most common fungi associated with corn worldwide. Fumonisins are known to cause equine leukoencephalomalacia, a disease associated with the consumption of corn-based feeds contaminated with FB1. Here we have reported chronic experimental toxicosis in one-year-old carp (Cyprinus carpio L.) receiving f...
Sutton G, Normand C, Carnet F, Couroucé A, Garvey M, Castagnet S, Fortier CI, Hue ES, Marcillaud-Pitel C, Legrand L, Paillot R, Pitel PH....Equine herpesvirus 1 isolates from a 2021 outbreak of neurologic disease in Europe have a mutation, A713G, in open reading frame 11 not detected in 249 other sequences from equine herpesvirus 1 isolates. This single-nucleotide polymorphism could help identify horses infected with the virus strain linked to this outbreak.
FEEMSTER RF.This research focuses on the first recognized human infection of equine encephalomyelitis, a disease mostly found in horses, which occurred in Massachusetts in the summer of 1938. The study dives […]
Episodic collapse in horses has equine welfare and human safety implications. There are, however, no published case series describing this syndrome. Objective: To characterize the cause and outcomes for horses referred for investigation of episodic collapse. Methods: Twenty-five horses referred for investigation of single or multiple episodes of collapse. Methods: Retrospective study. Clinical records from the Dick Vet Equine Hospital, University of Edinburgh from November 1995 to July 2009 were searched using the following keywords: collapse, collapsing, fall, syncope. Collapse was defined as...
Rejmanek D, Miller MA, Grigg ME, Crosbie PR, Conrad PA.Sarcocystis neurona is a significant cause of neurological disease in horses and other animals, including the threatened Southern sea otter (Enhydra lutris nereis). Opossums (Didelphis virginiana), the only known definitive hosts for S. neurona in North America, are an introduced species in California. S. neurona DNA isolated from sporocysts and/or infected tissues of 10 opossums, 6 horses, 1 cat, 23 Southern sea otters, and 1 harbor porpoise (Phocoena phocoena) with natural infections was analyzed based on 15 genetic markers, including the first internal transcribed spacer (ITS-1) region; the...
De la Rúa-Domènech R, Mohammed HO, Cummings JF, Divers TJ, De Lahunta A, Summers BA.Equine motor neuron disease (EMND) is a neurodegenerative disorder of the somatic lower motor neurons that results in a syndrome of diffuse neuromuscular disease in the adult horse. The aetiology of this disorder is unknown, although prior studies have suggested that a deficiency in the lipid antioxidant vitamin E (alpha-tocopherol) contributes to the development of EMND. This paper describes a case-control study designed to investigate the association between plasma vitamin E levels and the risk of EMND for horses. Signalment, plasma vitamin E levels at the time of referral, and information r...
Hahn CN, Matiasek K, Dixon PM, Molony V, Rodenacker K, Mayhew IG.Recurrent laryngeal neuropathy (RLN) is a common and debilitating peripheral nerve disease of horses, but it remains unclear if this disease is a mono- or polyneuropathy. An understanding of the distribution of the neuropathological lesions in RLN affected horses is fundamental to studying the aetiology of this very significant disease of tall horses. Objective: To determine whether RLN should be classified as a mono- or polyneuropathy. Methods: Multiple long peripheral nerves and their innervated muscles were examined systematically in 3 clinically affected RLN horses Results: Severe lesions ...
Claridge HA, Piercy RJ, Parry A, Weller R.REASONS FOR STUDY: Detailed anatomy of the equine cervical articular process joints (APJs) has received little attention in the literature and yet disorders of this joint have been linked to spinal cord compression resulting in severe clinical signs such as ataxia and weakness. This study aimed to describe the 3D anatomy of the APJ in relation to the spinal cord in the horse. Objective: Artificial distension of the APJ causes the joint pouches to extend into the vertebral canal, with the potential for APJ effusion to cause spinal cord compressive disease. Methods: Six cadaveric necks (C1-C7) o...
Lindsay DS, Mitchell SM, Vianna MC, Dubey JP.Equine protozoal myeloencephalitis is a major cause of neurological disease in horses from the Americas. Horses are considered accidental intermediate hosts. The structure of sporocysts of the causative agent, Sarcocystis neurona, has never been described. Sporocysts of S. neurona were obtained from the intestines of a laboratory-raised opossum fed skeletal muscles from a raccoon that had been fed sporocysts. Sporocysts were 11.3 by 8.2 microm and contained 4 sporozoites. The appearance of the sporocyst residuum was variable. The residuum of some sporocysts was composed of many dispersed granu...
Moore BR, Reed SM, Biller DS, Kohn CW, Weisbrode SE.Magnification of cervical radiographs prevents accurate interpretation of vertebral canal absolute minimum sagittal diameter (MSD) values and application of the established MSD values for diagnosis of cervical stenotic myelopathy (CSM). Variability in MSD determination in human beings, owing to radiographic magnification, is minimized by assessing a ratio of the vertebral canal diameter to the sagittal width of the vertebral body. This relative measurement technique improves the accuracy of diagnosis of cervical spinal stenosis in human beings. The MSD of the vertebral canal was determined in ...
Chou CC, Vickroy TW.To determine the presence of adenosine receptor subtypes A1 and A2a in equine forebrain tissues and to characterize the interactions of caffeine and its metabolites with adenosine receptors in the CNS of horses. Methods: Brain tissue specimens obtained during necropsy from 5 adult male research horses. Methods: Membrane-enriched homogenates from cerebral cortex and striatum were evaluated by radioligand binding assays with the A1-selective ligand [3H]DPCPX and the A2a-selective ligand [3H]ZM241385. Functional responses to adenosine receptor agonists and antagonists were determined by a nucleot...
Manso-Díaz G, Dyson SJ, Dennis R, García-López JM, Biggi M, García-Real MI, San Román F, Taeymans O.The equine head is an anatomically complex area, therefore advanced tomographic imaging techniques, such as computed tomography or magnetic resonance imaging (MRI), are often required for diagnosis and treatment planning. The purpose of this multicenter retrospective study was to describe MRI characteristics for a large sample of horses with head disorders. Horses imaged over a period of 13 years were recruited. Eighty-four horses met the inclusion criteria, having neurological (n = 65), sinonasal (n = 14), and soft tissue (n = 5) disorders. Magnetic resonance imaging accurately depicted the a...
Cavalleri JM, Metzger J, Hellige M, Lampe V, Stuckenschneider K, Tipold A, Beineke A, Becker K, Distl O, Feige K.Cerebellar abiotrophy (CA) is a rare but significant disease in Arabian horses caused by progressive death of the Purkinje cells resulting in cerebellar ataxia characterized by a typical head tremor, jerky head movements and lack of menace response. The specific role of magnetic resonance imaging (MRI) to support clinical diagnosis has been discussed. However, as yet MR imaging has only been described in one equine CA case. The role of MR morphometry in this regard is currently unknown. Due to the hereditary nature of the disease, genetic testing can support the diagnosis of CA. Therefore, the...
Rosiles MR, Bautista J, Fuentes VO, Ross F.Equine leukoencephalomalacia (ELEM), swine pulmonary oedema and human oesophageal cancer have been associated with fumonisine B1 (FB1) ingestion. For the first time in this study it is reported that FB1 was identified as being associated with an outbreak of ELEM at Oaxaca, Mexico. Symptoms of ELEM and Equine Venezuelan Encephalitis (EVE) are similar and a different diagnosis is obligatory. In the geographical area (Oaxaca, Mexico) where donkeys died showing a neurological syndrome, 14 corn samples were collected. With the use of TLC (Thin layer chromatography) and HPLC (High performance liquid...
Mullaney T, Murphy AJ, Kiupel M, Bell JA, Rossano MG, Mansfield LS.Opossums (Didelphis spp.) are the definitive host for the protozoan parasite Sarcocystis neurona, the causative agent of equine protozoal myeloencephalitis (EPM). Opossums shed sporocysts in feces that can be ingested by true intermediate hosts (cats, raccoons, skunks, armadillos and sea otters). Horses acquire the parasite by ingestion of feed or water contaminated by opossum feces. However, horses have been classified as aberrant intermediate hosts because the terminal asexual sarcocyst stage that is required for transmission to the definitive host has not been found in their tissues despite...
Nollet H, Deprez P, Van Ham L, Verschooten F, Vanderstraeten G.The aim of this study was to investigate the use of magnetic motor evoked potentials as an ancillary diagnostic test in horses with cervical cord lesions. Transcranial magnetic stimulation was performed in 12 ataxic horses and the results of the evoked responses were compared to those found in normal horses. The latency and peak-to-peak amplitude of the potentials in the 12 ataxic horses were significantly different from those measured in normal horses. The configuration of the abnormal potentials was also polyphasic. Normalisation of the evoked potentials occurred in none of the horses, prese...
Haliburton JC, Vesonder RF, Lock TF, Buck WB.Signs and lesions characteristic of equine leucoencephalomalacia were produced in one of two donkeys given corn cultured with Fusarium moniliforme Sheldon. Gross and histopathologic lesions of the cerebrum included an extensive necrotic cavitation within one cerebral hemisphere, disruption and rarefication of the subcortical white matter, prominent perivascular hemorrhage, and some mononuclear cell perivascular cuffing. Another donkey and three rabbits fed the cultured corn did not develop characteristic signs or lesions of the toxicosis. Chick bioassay studies indicated that the cultured corn...
Johnson AL, Morrow JK, Sweeney RW.Recent research suggests that serum : CSF titer ratios could provide the most accurate antemortem diagnosis of equine protozoal myeloencephalitis (EPM) caused by Sarcocystis neurona. Objective: The purpose of this study was to assess the utility of two commercially available tests, the indirect fluorescent antibody test (IFAT) and the surface antigen 2, 4/3 ELISA (SAG2, 4/3 ELISA), using archived paired serum and CSF samples. Methods: Samples were obtained from 4 types of clinical patients. Confirmed positive cases (n = 9 horses; 11 sample sets) had neurologic deficits and postmortem lesions c...
Chowdhury SI, Kubin G, Ludwig H.Out of 30 cases of abortion and perinatal deaths in a Lipizzaner stud in Austria 10 mares died after having shown central nervous system disturbances, ataxias and paralysis. The etiological agent of this "abortion storm" was equine herpesvirus type 1 (EHV-1). The restriction enzyme pattern of the DNA from 5 isolates recovered from fetuses has been analyzed and compared with the known reference strains of EHV-1, -2, -4 and an Austrian vaccine strain. The DNA restriction profiles of the Lipizzaner isolates as well as of the vaccine strain could be identified as being typical of abortigenic strai...
Fouché N, Oesch S, Ziegler U, Gerber V.Tick-borne encephalitis is an important viral tick-borne zoonosis in Europe and Asia. The disease is induced by tick-borne encephalitis virus (TBEV). This report describes a 16-year-old Warmblood gelding presenting with sudden onset of lethargy, ataxia, and muscle fasciculations on the nostrils, the lips, and the eye lids as the most important clinical findings. The horse further had a mild facial nerve paralysis with drooping of the right upper and lower lip. Diagnosis was based on paired serum samples using TBEV-ELISAs revealing high serum IgM in the first sample with normal IgM in the secon...
Kligler EB, Shkap V, Baneth G, Mildenberg Z, Steinman A.Sera from 800 asymptomatic horses were examined for the presence of antibodies to Neospora caninum by immunofluorescence antibody test (IFAT). The presence of antibodies to N. caninum was also tested in sera from 52 mares that had aborted and 40 horses exhibiting neurological signs. A total of 95 (11.9%) of the 800 sera had antibodies for Neospora. Significantly higher seropositivity was obtained from horses that had neurological signs (21.2%) and from aborted mares (37.5%). There was significant linear-by-linear association between age and seropositivity. This is the first serologic survey fo...