Neurological diseases in horses encompass a range of disorders affecting the central and peripheral nervous systems. These conditions can arise from various etiologies, including infectious agents, genetic predispositions, trauma, or metabolic imbalances. Common neurological diseases in horses include equine protozoal myeloencephalitis (EPM), equine herpesvirus myeloencephalopathy (EHM), and cervical vertebral stenotic myelopathy (CVSM), also known as wobbler syndrome. Clinical signs associated with these diseases may include ataxia, weakness, altered gait, and changes in behavior or mental status. Diagnosis typically involves a combination of clinical evaluation, imaging techniques, and laboratory testing. This page compiles peer-reviewed research studies and scholarly articles that investigate the pathophysiology, diagnostic approaches, and treatment options for neurological diseases in equine populations.
Pusterla N, Hatch K, Crossley B, Wademan C, Barnum S, Flynn K.The objective of this study was to determine if the genotype of equine herpesvirus-1 (EHV-1) impacted clinical disease and outcome of horses with laboratory confirmed equine herpesvirus myeloencephalopathy (EHM). Medical records from 65 horses diagnosed with EHM from 2011 to 2019 were reviewed for signalment, presence and severity of clinical signs (lethargy, fever, ataxia, urinary incontinence) and outcome. Horses were further grouped based on the EHV-1 genotype into neuropathic (D) or non-neuropathic (N) EHV-1 infection. Between the two EHV-1 genotype groups, age and sex distributions were s...
Bernstock JD, Ostby S, Fox B, Sotoudeh H, Janssen A, Kang YJ, Chen J, Prattipati V, Elsayed G, Chagoya G, Yamashita D, Friedman GK, Nabors B, Huh WK....Leptomeningeal metastasis is extremely rare in patients with ovarian cancer, but should be considered in patients presenting with neurologic deficits such as cauda equine syndrome. Given its poor prognosis and lack of data currently on management, additional studies are needed to optimize treatment regimens and improve outcomes.
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Altan E, Li Y, Sabino-Santos G, Sawaswong V, Barnum S, Pusterla N, Deng X, Delwart E.Metagenomics was used to identify viral sequences in the plasma and CSF (cerobrospinal fluid) of 13 horses with unexplained neurological signs and in the plasma and respiratory swabs of 14 horses with unexplained respiratory signs. Equine hepacivirus and two copiparvoviruses (horse parvovirus-CSF and a novel parvovirus) were detected in plasma from neurological cases. Plasma from horses with respiratory signs contained the same two copiparvoviruses plus equine pegivirus D and respiratory swabs contained equine herpes virus 2 and 5. Based on genetic distances the novel copiparvovirus qualified ...
Draper ACE, Cahalan SD, Goodwin D, Perkins J, Piercy RJ.Equine recurrent laryngeal neuropathy (RLN) is a naturally occurring model of length-dependent axonopathy characterized by asymmetrical degeneration of recurrent laryngeal nerve axons (RLn). Distal RLn degeneration is marked, but it is unclear whether degeneration extends to include cell bodies (consistent with a neuronopathy). With examiners blinded to RLN severity, brainstem location, and side, we examined correlations between RLN severity (assessed using left distal RLn myelinated axon count) and histopathological features (including chromatolysis and glial responses) in the nucleus ambiguu...
Sutton G, Garvey M, Cullinane A, Jourdan M, Fortier C, Moreau P, Foursin M, Gryspeerdt A, Maisonnier V, Marcillaud-Pitel C, Legrand L, Paillot R....Equine herpesvirus 1 (EHV-1) is an Alphaherpesvirus infecting not only horses but also other equid and non-equid mammals. It can cause respiratory distress, stillbirth and neonatal death, abortion, and neurological disease. The different forms of disease induced by EHV-1 infection can have dramatic consequences on the equine industry, and thus the virus represents a great challenge for the equine and scientific community. This report describes the progress of a major EHV-1 outbreak that took place in Normandy in 2009, during which the three forms of disease were observed. A collection of EHV-1...
Johnson PJ, Janvier V, Luh WM, FitzMaurice M, Southard T, Barry EF.There is growing interest in the horse for behavioral, neuroanatomic and neuroscientific research due to its large and complex brain, cognitive abilities and long lifespan making it neurologically interesting and a potential large animal model for several neuropsychological diseases. Magnetic resonance imaging (MRI) is a powerful neuroscientific research tool that can be performed , with adapted equine facilities, or in the research setting. The brain atlas is a fundamental resource for neuroimaging research, and have been created for a multitude animal models, however, none currently exist f...
Moreno KL, Scallan EM, Friedeck WO, Simon BT.Pelvic limb neuropathy is a rare post-anaesthetic complication. In the authors' experiences, the incidence of post-anaesthesia neuropathy is increased following MRI of the proximal metatarsus and tarsal regions when compared with previously reported incidences of post-anaesthetic neuropathy. Objective: This study reports the incidence, diagnosis, treatment and outcome of seven horses with post-anaesthesia neuropathy following proximal metatarsal and tarsal MRI. Methods: Retrospective case series. Methods: Case record review of horses receiving general anaesthesia for MRI between 1 January 2012...
Martin-Giménez T, Cruz AM, Barragán A, Montero E, Sanchez PG, Caballero G, Corradini I.Occipital condylar fractures (OCFs) causing delayed onset lower cranial nerve paralysis (LCNPs) are rare. We present a 7-year-old Friesian horse with delayed onset dysphagia caused by vagus nerve (CNX) paralysis and suspicion of glossopharyngeal nerve (CNIX) paralysis developed several days after a minor head injury. Endoscopic examination revealed right laryngeal hemiplegia and intermittent dorsal displacement of the soft palate. An area of submucosal hemorrhage and bulging was appreciated over the dorsal aspect of the medial compartment of the right guttural pouch. Radiological examination o...
Rijckaert J, Pardon B, Saey V, Raes E, Van Ham L, Ducatelle R, van Loon G, Deprez P.Transcranial magnetic stimulation (TMS) and recording of magnetic motor evoked potentials (MMEP) can detect neurological dysfunction in horses but cutoff values based on confirmed spinal cord dysfunction are lacking. Objective: To determine latency time cutoff for neurological dysfunction. Methods: Five control horses and 17 horses with proprioceptive ataxia. Methods: Case-control study with receiver operating characteristic curve analysis, based on diagnostic imaging, TMS, and histopathological findings. Horses were included if all 3 examinations were performed. Results: Diagnostic imaging an...
Marquardt SA, Wilcox CV, Burns EN, Peterson JA, Finno CJ.Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nuc...
Aleman M, McCue PM, Chigerwe M, Madigan JE.Transient hypothalamic-pituitary-adrenal axis dysfunction occurs in critically ill foals with sepsis and neonatal maladjustment syndrome (NMS). Cortisol is the most commonly measured steroid. However, a complex interaction of various steroid compounds might play a role in pathophysiology of this disorder. Objective: To identify steroid compounds present at high concentrations at birth that rapidly and steadily decrease within the first 7 days of life in healthy foals and that might be supportive diagnosis of NMS and other neonatal disorders. Methods: Ten healthy neonatal Quarter Horse foals ...
Lechmann J, Schoster A, Ernstberger M, Fouché N, Fraefel C, Bachofen C.Equid alphaherpesvirus 1 (EHV-1) infections can have a major impact on the horse industry and equine welfare by causing abortion or respiratory or neurologic disease. A single nucleotide polymorphism (A→G) in open reading frame (ORF) 30, encoding the catalytic subunit of the DNA polymerase, has been shown to be a strong predictive marker for neuropathogenicity. Given that a previously established real-time PCR (rtPCR) protocol yielded unsatisfactory results concerning determination of the EHV-1 genotype, we developed and evaluated a new conventional PCR protocol enabling identification of th...
Journée SL, de Meeus d'Argenteuil C, De Maré L, Boshuizen B, Vanderperren K, Journée LH, de Bruijn M, Bergmann W, Delesalle C.Spinal cord disorders are a common problem in equine medicine. However, finding the site of the lesion is challenging for veterinarians because of a lack of sensitive diagnostic methods that can assess neuronal functional integrity in horses. Although medical imaging is frequently applied to help diagnose corticospinal disorders, this approach does not reveal functional information. For the latter, transcranial magnetic stimulation (TMS) and more recently transcranial electrical stimulation (TES) can be useful. These are brain stimulation techniques that create either magnetic or electrical fi...
Racine J, O'Brien T, Bladon BM, Cruz AM, Stoffel MH, Haenssgen K, Rodgerson DH, Livesey MA, Koch C.To investigate the feasibility and complications associated with ceratohyoidectomy (CHE) in standing sedated horses unaffected (experimental horses) and standing sedated horses affected (clinical cases) with temporohyoid osteoarthropathy (THO). Methods: Case series. Methods: Six experimental horses and four clinical cases. Methods: Standing CHE was performed in six experimental horses euthanized 30 minutes (n = 3) and 7 days (n = 3) postoperatively. The four clinical cases were presented because of central facial nerve paralysis (n = 3), vestibular ataxia (n = 3), auricular hemorrhage (n =...
Szklarz M, Lipinska A, Slowikowska M, Niedzwiedz A, Marycz K, Janeczek M.Cervical vertebral stenotic myelopathy (CVSM) remains one of the most important abnormalities of the cervical spine resulting in neurological deficits in horses. The aim of the following study was to compare the results of the clinical and neurological examination, the results of myelography and the post mortem anatomical and histological appearance of the spinal cord and cervical vertebrae in a horse with CVSM. Methods: The following study describes a clinical case of an eight-month-old stallion with ataxia. Plain cervical radiographs indicated narrowing of the spinal canal. Conservative ther...
Milne EM, Pirie RS, Hahn CN, Del-Pozo J, Drummond D, Moss S, McGorum BC.Equine dysautonomia (ED) causes degeneration and loss of autonomic neurons. Approximately 50% of chronic cases recover, but it is unclear how they survive neuronal loss. Objective: To assess lesions, autonomic neuron numbers, interstitial cells of Cajal (ICC), and neurodegeneration in recovered cases. Methods: Thirteen cases (group ED), euthanized 10.3 ± 5.2 (1-16) years from diagnosis and 6 age-matched controls (group C). Methods: Prospective, case control; routine post mortem examination, neuron counts in peripheral and enteric ganglia and immunohistochemical assessment of neural networ...
Schulze N, Ehrle A, Noguera Cender AC, Lischer C.To report surgical treatment of a complete luxation of the atlantoaxial articulation with a 4.5-mm T-locking compression plate (T-LCP) in a horse. Methods: Case report. Methods: A one-year-old American quarter horse filly. Methods: A one-year-old American quarter horse filly presented with a complete luxation of the atlantoaxial articulation. Closed and open reduction of the luxation were attempted under general anesthesia with the aid of a pulley system. Because the manual reduction was unsuccessful, the dens axis was excised, and the atlas and axis were stabilized with a 4.5-mm T-LCP. Fo...
McElroy A, Rashmir A, Manfredi J, Sledge D, Carr E, Stopa E, Klinge P.Myodural bridges have been described in various species as connective tissue structures "bridging" small cranio-cervical muscles to the dura. Myodural bridges are thought to stabilize the dural sac during head and neck movements and promote cerebrospinal fluid motion; however, their role in neurological diseases has not yet been established. We report ultrasonographic visualization, necropsy, histopathologic and ultrastructural findings of myodural bridges in horses with hereditary equine regional dermal asthenia (HERDA), an equine model of Ehlers-Danlos syndromes. Five HERDA and 5 control hor...
Liu SJ, Wang Q, Tang HH, Bai JZ, Wang FY, Lv Z, Chen SZ, Liu JS, Hong Y, Zhang JW.Retrospective analysis. Methods: China Rehabilitation Research Center, Beijing, China. Objective: A retrospective study that documents the modalities and clarifies the heterogeneity among spinal cord injuries (SCIs) caused by trauma to the thoracolumbar vertebral junction. Methods: X-ray and MRI imaging, neurological records, and the urodynamics results of 190 patients were reviewed and used to categorize different SCI modalities. First, injuries were divided into complete and incomplete injuries using the International Standard for Neurological Classification of Spinal Cord Injury. Next, the ...
Marcinkowska M, Bucki A, Panek D, Siwek A, Fajkis N, Bednarski M, Zygmunt M, Godyń J, Del Rio Valdivieso A, Kotańska M, Kołaczkowski M....Serotonin 5-HT receptors, butyrylcholinesterase (BuChE) and oxidative stress are related to the pathophysiology of Alzheimer's disease. Inhibition of BuChE provides symptomatic treatment of the disease and the same effect was demonstrated for 5-HT antagonists in clinical trials. Oxidative stress is regarded as a major and primary factor contributing to the development of Alzheimer's disease; therefore, antioxidant agents may provide a disease-modifying effect. Combining BuChE inhibition, 5-HT antagonism, and antioxidant properties may result in multitarget-directed ligands providing cognitio...
Trumpp KM, Parsley AL, Lewis MJ, Camp JW, Taylor SD.Tick paralysis has not been reported in horses in North America. Results: Two American Miniature horses were examined for progressive weakness and recumbency. Numerous ticks (Dermacentor variabilis) were found on both horses. Horse 1 was recumbent (grade 5/5 gait deficit) on presentation, whereas Horse 2 was standing but ataxic (grade 4/5 gait deficit) and tetraparetic. Both horses had decreased tongue and tail muscle tone, and had normal spinal reflexes. Cerebrospinal fluid cytology was normal. Equine herpesvirus-1 testing was negative. Unassigned: Ticks were removed within 24 hours of pres...
Buck AM, Hunt RJ.To describe the surgical correction of a closed meningoencephalocele in a thoroughbred filly. Methods: Case report. Methods: One thoroughbred filly, 1.5 months old at the time of surgery. Methods: A meningoencephalocele was identified at birth and diagnosed with radiography and MRI. The abnormal tissue was excised and submitted for histopathology, the dura was closed, and the defect in the skull was corrected with a titanium mesh. Results: Histopathology confirmed the presence of neural parenchyma consisting of neurons and glial cells. The filly remained without neurologic deficits 7 month...
Miranda IC, Taylor KR, Castleman W, de Lahunta A, Summers BA, Miller AD.Proliferation of ectopic Schwann cells within the central nervous system (CNS) parenchyma (schwannosis) in early life is most commonly associated with human neurofibromatosis type-2 and has been unrecognized in domestic animals. Three foals and a calf, 5 to 11 weeks old, with progressive neurological signs from birth were studied. Histologically, at multiple levels of the spinal cord, all animals had bilateral plaques of proliferative spindle cells, predominantly affecting the white matter adjacent to dorsal and ventral nerve roots and variably extending into the gray matter. Proliferating cel...
Morales Gómez AM, Zhu S, Palmer S, Olsen E, Ness SL, Divers TJ, Bischoff K, Mohammed HO.Neurofilaments (NFs) are structural proteins of neurons that are released in significant quantities in the cerebrospinal fluid and blood as a result of neuronal degeneration or axonal damage. Therefore, NFs have potential as biomarkers for neurologic disorders. Neural degeneration increases with age and has the potential to confound the utility of NFs as biomarkers in the diagnosis of neurologic disorders. We investigated this relationship in horses with and without neurological diagnosis. While controlling for horse type (draft, pleasure, and racing), we evaluated the relationship between ser...
Toribio RE.Neonatal encephalopathy (NE) and neonatal maladjustment syndrome (NMS) are terms used for newborn foals that develop noninfectious neurologic signs in the immediate postpartum period. Cerebral ischemia, hypoxia, and inflammation leading to neuronal and glial dysfunction and excitotoxicity are considered key mechanisms behind NE/NMS. Attention has been placed on endocrine and paracrine factors that alter brain cell function. Abnormal steroid concentrations (progestogens, neurosteroids) have been measured in critically ill and NE foals. In addition to supportive treatment, antimicrobials should ...
Hay AN, Witonsky SG, Lindsay DS, LeRoith T, Zhu J, Kasmark L, Leeth CM. is a ubiquitous parasite in the eastern United States, which is the principal causative agent in the neurologic disorder equine protozoal myeloencephalitis (EPM). While much is known about this protozoa's life cycle in its natural host, the opossum (), little is known of how it acts in the aberrant equine host, which displays a high incidence of exposure with a relatively low rate of morbidity. For this study, we employed the popular interferon gamma knockout mouse model to determine the potential for recrudescence of infection after treatment with the anticoccidial drug diclazuril. Mice wer...
Read AJ, Finlaison DS, Gu X, Hick PM, Moloney BJ, Wright T, Kirkland PD.Between February and June 2011, more than 300 horses with unexplained neurological disease were observed in New South Wales, Australia. A virulent strain of West Nile virus (WNV ), of Australian origin, was shown to be the cause of many of these cases. Methods: We reviewed the clinical descriptions provided by veterinary practitioners and the associated laboratory results. Although there was a range of clinical signs described, ataxia was the only sign that was consistently described in laboratory-confirmed cases. Results: WNV was detected in brain samples by real-time reverse transcription PC...
Bazzano M, McLean A, Tesei B, Gallina E, Laus F.Selenium and vitamin E protect the body against oxidative stress. Clinical manifestations of their deficiency in equids include neurologic and muscular symptoms. Despite the importance of donkeys as working and production animals, there is a dearth of scientific data on selenium and vitamin E normal values. Therefore, the aim of this study was to investigate the plasma concentrations of selenium and vitamin E in healthy donkeys belonging to different ages, sexes, and productive phases. Animals were divided into five groups including foals (group A: n = 7, n = 4 males and n = 3 females), wea...
Carrasco L, Utrilla MJ, Fuentes-Romero B, Fernandez-Novo A, Martin-Maldonado B.West Nile Virus (WNV) is a zoonotic, vector-borne pathogen affecting humans and animals, particularly in Europe. The virus is primarily transmitted through mosquitoes that infect birds, which serve as the main reservoirs. Humans and horses are incidental hosts. This review focuses on the epidemiology of WNV in southern Europe, particularly its increasing prevalence. Methods included an extensive literature review and analysis of recent outbreaks. WNV is largely asymptomatic in humans, but a small percentage can develop West Nile neuroinvasive disease (WNND), leading to severe neurological symp...
McGorum BC, Pirie RS, Eaton SL, Keen JA, Cumyn EM, Arnott DM, Chen W, Lamont DJ, Graham LC, Llavero Hurtado M, Pemberton A, Wishart TM.Equine grass sickness (EGS) is an acute, predominantly fatal, multiple system neuropathy of grazing horses with reported incidence rates of ∼2%. An apparently identical disease occurs in multiple species, including but not limited to cats, dogs, and rabbits. Although the precise etiology remains unclear, ultrastructural findings have suggested that the primary lesion lies in the glycoprotein biosynthetic pathway of specific neuronal populations. The goal of this study was therefore to identify the molecular processes underpinning neurodegeneration in EGS. Here, we use a bottom-up approach be...
Mironneau J, Martin C, Arnaudeau S, Jmari K, Rakotoarisoa L, Sayet I, Mironneau C.Saturable, high-affinity binding sites for [3H]saxitoxin were identified in equine portal vein smooth muscle membranes. These sites had a dissociation constant of 0.29 nM and a maximal binding capacity of 115 fmol.mg-1 of protein. A similar dissociation constant was obtained with cells prepared from rat portal vein. Specific binding of [3H]saxitoxin was completely displaced by unlabelled saxitoxin and tetrodotoxin, with inhibition constants of 0.42 and 2.10 nM, respectively. Tetrodotoxin blocked the fast Na+ current in single cells of rat portal vein in a concentration-dependent manner, with a...
Lee H, Hwang H, Ro Y, Kim JH, Lee K, Choi E, Bae Y, So B, Lee I.This study was performed to examine and clarify the cause of hindlimb ataxia and neuropathy seen in the South Korean horse population. Fifty horses diagnosed with hindlimb ataxia and neuropathy were referred for this study. Neurological examination was performed on 47 horses while necropsy was performed in all 50 animals. The occurrence of neurological diseases increased rapidly in the summer and 47 out of 50 horses were referred after the end of July. The incidence of neurological diseases started from the southern part of Korea in July and proceeded northward in August and September. Althoug...
Granstrom DE, Alvarez O, Dubey JP, Comer PF, Williams NM.Schizonts of Sarcocystis neurona were identified microscopically in hematoxylin-eosin-stained spinal cord sections from 2 native Panamanian horses that exhibited clinical signs of equine protozoal myelitis (EPM). Spinal cord homogenate from a third Panamanian horse with EPM was inoculated onto monolayers of cultured bovine monocytes (M617). Intracytoplasmic schizonts containing merozoites arranged in rosette forms surrounding a central residual body first were observed 13 wk postinoculation. Parasites divided by endopolygeny and lacked rhoptries. Schizonts from each horse reacted with Sarcocys...
Khusro A, Aarti C, Buendía-Rodriguez G, Arasu MV, Al-Dhabi NA, Barbabosa-Pliego A.Antibiotics-based therapy plays a paramount role in equine medicine because of their potential pharmacokinetics and pharmacodynamics properties. Conventional antibiotics show bacteriostatic and bactericidal properties by interfering bacterial cell wall and protein synthesis as well as inhibiting RNA polymerase, DNase 1, and DNA gyrase. Antibiotics are extensively used not only for the treatment of varied bacterial infections but also the prevention of postoperative and secondary infections. Surprisingly, antibiotics such as sulfonamides or trimethoprim/sulfonamide combinations, benzylpenicilli...
Bröjer JT, Parsons DA, Linder KE, Peregrine AS, Dobson H.An 8-year-old, Arabian mare presented with acute progressive ataxia and a firm swelling over the right mandible. Radiographs revealed multiple radiolucent areas on the mandibles. The mare's neurological signs progressed, she was consequently euthanized. Postmortem examination revealed mandibular granulomatous reactions and meningoencephalitis due to the nematode Halicephalobus gingivalis.
Roberts VL, Fews D, McNamara JM, Love S.Trigeminal-mediated headshaking is an idiopathic neuropathic facial pain syndrome in horses. There are clinical similarities to trigeminal neuralgia, a neuropathic facial pain syndrome in man, which is usually caused by demyelination of trigeminal sensory fibers within either the nerve root or, less commonly, the brainstem. Our hypothesis was that the neuropathological substrate of headshaking in horses is similar to that of trigeminal neuralgia in man. Trigeminal nerves, nerve roots, ganglia, infraorbital, and caudal nasal nerves from horse abattoir specimens and from horses euthanized due to...
Foreman JH, Constable PD, Waggoner AL, Levy M, Eppley RM, Smith GW, Tumbleson ME, Haschek WM.The objective of this experiment was to characterize a dose-dependent toxic effect of fumonisin B1 (FB1) and to document initial neurologic signs, clinical progression, and terminal cerebrospinal fluid (CSF) changes in horses administered FB1 IV. Seventeen healthy horses were administered 0.00 (n = 4), 0.01 (n = 3), 0.05 (n = 3), 0.10 (n = 3), or 0.20 mg (n = 4) of purified FB1 IV q24h. When neurologic abnormalities observed by a masked observer became severe, atlanto-occipital CSF taps were performed and CSF pressure, cell count, cytology, protein, albumin and glucose concentrations, and crea...
Prange T, Derksen FJ, Stick JA, Garcia-Pereira FL, Carr EA.Despite modern medical diagnostic imaging, it is not possible to identify reliably the exact location of spinal cord compression in horses with cervical vertebral stenotic myelopathy (CVSM). Vertebral canal endoscopy has been successfully used in man and a technique for cervical vertebral canal endoscopy (CVCE) has been described in equine cadavers. Objective: To determine the feasibility and safety of CVCE in healthy mature horses. Methods: Six healthy mature horses were anaesthetised. A flexible videoendoscope was subsequently introduced via the atlanto-occipital space into the epidural spac...
Marcinkowska M, Bucki A, Panek D, Siwek A, Fajkis N, Bednarski M, Zygmunt M, Godyń J, Del Rio Valdivieso A, Kotańska M, Kołaczkowski M....Serotonin 5-HT receptors, butyrylcholinesterase (BuChE) and oxidative stress are related to the pathophysiology of Alzheimer's disease. Inhibition of BuChE provides symptomatic treatment of the disease and the same effect was demonstrated for 5-HT antagonists in clinical trials. Oxidative stress is regarded as a major and primary factor contributing to the development of Alzheimer's disease; therefore, antioxidant agents may provide a disease-modifying effect. Combining BuChE inhibition, 5-HT antagonism, and antioxidant properties may result in multitarget-directed ligands providing cognitio...
Divers TJ, Mohammed HO, Cummings JF.This article reviews the subject of equine motor neuron disease, a neurodegenerative disease of horses. The authors discuss various topics, including epidemiology, pathophysiology, clinical signs, laboratory findings, diagnosis, and treatment.
Johnson PJ.Laboratory electrolyte and acid-base analyses are important for the characterization and assessment of the severity of disorders of fluid balance, and they enable the veterinarian to institute appropriate corrective therapeutic interventions. Abnormalities of electrolytes or acid-base rarely define the diagnosis, but certain diseases are characterized by predictable trends in these parameters. Important clinical situations in which assessment of electrolyte and acid-base status should be regarded as important to the equine practitioner include diarrhea, severe colic, peritonitis, pleuritis, dy...
James KE, Smith WA, Packham AE, Conrad PA, Pusterla N.While toxoplasmosis is not commonly considered a clinical disease of equines, previous seroprevalence studies have reported differing background rates of Toxoplasma gondii infection in horses globally. The objective of this study was to evaluate possible associations between T. gondii seroprevalence and clinical signs of equine protozoal myeloencephalitis (EPM) in horses. Using a case-control study design, 720 Californian horses with neurologic signs compatible with EPM were compared to healthy, non-neurologic horses for the presence of T. gondii antibodies (using indirect fluorescent antibody...
Centonze R, Agostini E, Massaccesi S, Toninelli S, Morabito L.A large variety of biological and artificial materials are employed in dural repair, each of them with major limitations. Autologous grafts have limited availability and require an additional incision and surgical time. Cadaveric preparations and heterologous materials entail the risk of iatrogenic transmission of prions, whereas synthetic substitutes have been reported to cause inflammatory reactions and graft rejection. An equine-derived pericardium membrane has been developed (Heart(®), Bioteck, Vicenza, Italy) with mechanical and safety-related features that could make it suitable for neu...
Gazzeri R, Neroni M, Alfieri A, Galarza M, Faiola A, Esposito S, Giordano M.Numerous materials have been used to replace defects in the dura mater as result of neurosurgical and spinal procedures. Tissudura is a biomatrix made of cross-linked equine collagen fibrils, mainly of the interstitial type I. The specially engineered dura-like layered structure provides a non porous primary water tight structure, is transparent and allows verification of the efficacy of cerebral hemostasis. Methods: A consecutive series of patients between 18 years and 75 years of age were prospectively enrolled from three separate European institutions between May 2007 and February 2008. All...
Millis DL, Bergh A.Light therapy, or photobiomodulation, is a collective name for methods where tissue is irradiated with different types of light, with the aim of stimulating healing. Despite being frequently used, there is no consensus regarding the optimal treatment protocols for light therapy, nor its clinical efficacy. A systematic literature review was conducted, searching the relevant literature regarding light therapy in three databases, published between 1980-2020. The risk of bias in each article was evaluated. Forty-five articles met the inclusion criteria; 24 articles were regarding dogs, 1 was regar...
Conze TM, Bagó Z, Revilla-Fernández S, Schlegel J, Goehring LS, Matiasek K.A final diagnosis in a horse with clinical signs of encephalopathy can be challenging despite the use of extensive diagnostics. Clinical signs are often not pathognomonic and need to be interpreted in combination with (specific) laboratory results and epidemiological data of the geographical region of the origin of the case(s). Here we describe the diagnostic pathway of tick-borne encephalitis virus infection in two horses using established molecular diagnostic methods and a novel in situ hybridization technique to differentiate between regionally important/emerging diseases for central Europe...
Marsh AE, Barr BC, Madigan J, Lakritz J, Nordhausen R, Conrad PA.Neosporosis was diagnosed in an 11-year-old Quarter Horse gelding with clinical signs and diagnostic test results compatible with equine protozoal myeloencephalitis (EPM). Presumptive postmortem diagnosis of EPM attributable to Sarcocystis neurona infection is generally made on the basis of detecting an antibody titer to S neurona in the CSF or characteristic histologic lesions, even when parasites have not been specifically identified. Neosporosis was confirmed in the horse described here by use of immunohistochemical examination, in vitro culturing, and ultrastructural and molecular characte...
Nollet H, Van Ham L, Dewulf J, Vanderstraeten G, Deprez P.The influence of coil position on the peak-to-peak amplitude and onset latency of transcranial magnetic motor evoked potentials (MMEPs) in the extensor carpi radialis and cranial tibial muscles of horses was evaluated. Seven different stimulating coil positions were obtained by constructing a frame on the forehead. Two stimulation intensities (80% and 100% of maximal stimulator output) and two different coil currents (clockwise and counter-clockwise) were tested. For both recording sites MMEPs with the shortest onset latency and the largest peak-to-peak amplitude were detected when the coil wa...
Scholes SF, Vaillant C, Peacock P, Edwards GB, Kelly DF.The degeneration of enteric neurones has been recorded in grass sickness, but the distribution of the lesions in the gut and their possible relationship with the severity of the clinical signs has not been established. Samples obtained from 11 anatomically defined sites along the gastrointestinal tract of eight control horses without gastrointestinal disease, five horses with acute grass sickness and three horses with chronic grass sickness were examined histologically. The organisation of the enteric ganglia was similar to that in other large mammalian species. Minor exceptions included the p...
Gutiérrez S, Thébaud G, Smith DR, Kenney JL, Weaver SC.The within-host diversity of virus populations can be drastically limited during between-host transmission, with primary infection of hosts representing a major constraint to diversity maintenance. However, there is an extreme paucity of quantitative data on the demographic changes experienced by virus populations during primary infection. Here, the multiplicity of cellular infection (MOI) and population bottlenecks were quantified during primary mosquito infection by Venezuelan equine encephalitis virus, an arbovirus causing neurological disease in humans and equids.
Solbrig MV.Borna disease (BD), caused by the neurotropic RNA virus, Borna Disease virus, is an affliction ranging from asymptomatic to fatal meningoencephalitis across naturally and experimentally infected warmblooded (mammalian and bird) species. More than 100 years after the first clinical descriptions of Borna disease in horses and studies beginning in the 1980's linking Borna disease virus to human neuropsychiatric diseases, experimentally infected rodents have been used as models for examining behavioral, neuropharmacological, and neurochemical responses to viral challenge at different stages of lif...
Caterina Termine, Göran Akerström and Gonçalo Paixão of the Fédération Equestre Internationale's Veterinary Department describe the management of an outbreak of neurological equine herpesvirus 1 that affected a number of international showjumping events in Europe earlier this year.
Lepage OM, Perron MF, Cadoré JL.Advances in the understanding of guttural pouch physiology and novel therapeutic approaches to mycotic infections in the horse are reviewed. It is suggested that the guttural pouches may contribute to the regulation of arterial blood temperature, cooling the circulation to the brain to below body temperature. Aspergillus spp. is the major organism found in a guttural pouch affected with mycosis but it is unclear why this agent becomes aggressive. Conventional therapy aims to prevent fatal haemorrhage and to treat any neurological lesions but it is desirable to try to prevent the disease. A tec...
Aleman M, Pickles KJ, Simonek G, Madigan JE.Trigeminal neuralgia or neuropathic pain has been regarded as a putative cause of idiopathic headshaking in horses. Equine herpesvirus-1 (EHV-1) infection and resultant postherpetic pain have been suggested as a possible cause of such neuropathic pain. Objective: To determine the presence of EHV-1 in the trigeminal ganglia of horses with idiopathic headshaking. Methods: Nineteen horses: control (n = 11, 9 geldings, 2 mares, median age 11 years) and headshaking (n = 8, all geldings, median age 11.5 years) horses were sourced from the equine research herd and caseload at the Veterinary Medical T...
Brault LS, Famula TR, Penedo MC.To determine the mode of inheritance for cerebellar abiotrophy (CA), a neurologic disease in Arabians. Methods: 804 Arabians, including 29 horses (15 males and 14 females) with CA. Methods: Most horses (n = 755) belonged to 1 of 4 paternal families. Among the 29 CA-affected horses, all had clinical signs consistent with the disease; the disease was confirmed histologically following euthanasia in 8 horses. From the pedigree information, inbreeding coefficients were calculated for 16 affected horses and compared with coefficients for a subgroup of 16 unaffected horses. Complex segregation analy...
Studdert MJ, Hartley CA, Dynon K, Sandy JR, Slocombe RF, Charles JA, Milne ME, Clarke AF, El-Hage C.Five of 10 pregnant, lactating mares, each with a foal at foot, developed neurological disease. Three of them became recumbent, developed complications and were euthanased; of the two that survived, one aborted an equine herpesvirus type 1 (EHV-1)-positive fetus 68 days after the first signs were observed in the index case and the other gave birth to a healthy foal on day 283 but remained ataxic and incontinent. The diagnosis of EHV-1 myeloencephalitis was supported by postmortem findings, PCR identification of the virus and by serological tests with an EHV-1-specific ELISA. At the time of the...
Fortuna PRJ, Bielefeldt-Ohmann H, Ovchinnikov DA, Wolvetang EJ, Whitworth DJ.Horses are susceptible to a number of neurotropic viruses, including West Nile virus (WNV), which is a pathogen of global significance in both horses and humans. However, there are no in vitro models with which to study infectious neuropathic diseases in the horse. In an effort to redress this, we have generated neurons from equine induced pluripotent stem cells (equiPSCs) that express a range of cortical neuron-specific markers, in addition to the membrane-bound ligand ephrin B3, which plays an important role in axon guidance as well as functioning as the receptor through which henipaviruses,...
