Seizures in horses are neurological events characterized by sudden, uncontrolled electrical disturbances in the brain. These episodes can manifest as changes in behavior, motor activity, or consciousness and may vary in duration and severity. The underlying causes of seizures in horses can include genetic predispositions, metabolic disorders, infections, or traumatic brain injuries. Diagnosis often involves a combination of clinical examination, neurological assessment, and diagnostic imaging. This topic encompasses peer-reviewed research studies and scholarly articles that explore the etiology, pathophysiology, diagnostic approaches, and management strategies for seizures in equine patients.
Migliorisi A.The goal of this article is to provide the equine practitioners with a framework for a diagnostic algorithm for the patient presented with possible seizures/epilepsy. Using a comparative approach, a review of companion animal and human research is provided with the intention of expanding our current knowledge on seizure/epilepsy, as well as diagnostic and treatment strategies for equine patients.
Poci Palumbo MI, Maciel Cavalcante R, Martins Amorim R, De Vasconcelos Machado VM, Sousa Rocha N, Garcia Ribeiro M, Cagnini DQ, Secorun Borges A.Bacterial infection of the equine central nervous system is rare. This report describes the clinical features, computed tomography (CT) findings, and postmortem results of a 3-month-old female Quarter Horse with an intracranial abscess. Clinical signs included seizures, depression, and bilateral blindness. CT imaging demonstrated a large space-occupying lesion in the left cerebral hemisphere, associated with a frontal bone fracture. Necropsy and histopathology confirmed the presence of an abscess secondary to head trauma. Bacterial culture identified Streptococcus equi subsp. zooepidemicus as...
Di Cesare F, Negro V, Ravasio G, Villa R, Draghi S, Cagnardi P.Gabapentin is an anticonvulsant drug, which presents an established clinical efficacy in human patients for the management of refractory partial seizures, secondarily generalized tonic-clonic seizures, and for the control of chronic neuropathic pain. Gabapentin was synthesized as a structural analogue of the inhibitory neurotransmitter GABA, with GABA-mimetic effects, able to cross the blood-brain barrier. In veterinary medicine, is extra-label used in combination with other treatments to control seizures when other drugs are no longer effective or become toxic or for neuropathic pain treatmen...
Ciosek J, Kimes A, Vinardell T, Miller DC, Antczak DF, Brooks S.Valued for their temperament, beauty, athletic ability, and exhibition in the show ring, Arabian horses are an important component of the horse industry. Juvenile idiopathic epilepsy (JIE), a seizure disorder, is most often reported in Arabian foals from birth to 6 months of age. Affected foals exhibit tonic-clonic seizures lasting as long as 5 min and risking secondary complications like temporary blindness and disorientation. Some foals outgrow this condition, while others die or suffer lifelong complications if not treated. Previous work suggested a strong genetic component to JIE and propo...
Vinardell T, Elestwani S, Jamieson C, Karim E, Robin M, Glynn S, Benini R, Aleman M.A standardized protocol for electroencephalography (EEG) under standing sedation for the investigation of epilepsy in foals is needed. Objective: To evaluate a modified standardized EEG protocol under standing sedation using sublingual detomidine hydrochloride in Egyptian Arabian foals. Methods: Nineteen foals (controls, 9; juvenile idiopathic epilepsy [JIE], 10). Methods: Descriptive clinical study. Foals were classified as controls or epileptic based on history or witnessed seizures and neurological examination. Foals were sedated using sublingual detomidine hydrochloride at a dosage of 0.08...
Rissi DR, Avery AC, Burnett RC.T-cell-rich, large B-cell lymphoma (TCRLBCL) is the most commonly diagnosed type of lymphoma in horses. Here we describe the clinical signs, neuropathology, immunohistochemistry (IHC), and PCR for antigen receptor rearrangement (PARR) analysis results of a TCRLBCL in the brain of an 8-y-old male Quarter Horse that was euthanized after acute anorexia, tremors, head pressing, falling, blindness, incoordination, and seizures. Autopsy revealed a firm, smooth, pale-yellow mass that expanded both lateral ventricles and the adjacent subcortical white matter. Histologically, the mass consisted of a de...
Nout-Lomas YS.Mechanisms of traumatic nervous system injury to a degree are similar, but differences exist in etiology, pathophysiology, and treatment of brain, spinal cord, and peripheral nerve injury. The most common clinical abnormalities seen in the horse are abnormal level of consciousness, abnormal behavior, seizures, cranial nerve deficits, vestibular disease, tetra- and paraparesis or paraplegia, cauda equina syndrome, specific gait deficits, and muscle atrophy. Treatments are directed toward reducing inflammation and swelling, halting secondary injury, and promoting mechanisms of neuroregeneration ...
Polani S, Dean M, Lichter-Peled A, Hendrickson S, Tsang S, Fang X, Feng Y, Qiao W, Avni G, Kahila Bar-Gal G.Juvenile idiopathic epilepsy (JIE) is a self-limiting neurological disorder with a suspected genetic predisposition affecting young Arabian foals of the Egyptian lineage. The condition is characterized by tonic-clonic seizures with intermittent post-ictal blindness, in which most incidents are sporadic and unrecognized. This study aimed to identify genetic components shared across a local cohort of Arabian foals diagnosed with JIE via a combined whole genome and targeted resequencing approach: Initial whole genome comparisons between a small cohort of nine diagnosed foals (cases) and 27 contro...
Sakurai M, Isshiki S, Sasaki N, Sakai Y, Yamada Y, Morimoto M.A 7-year-old male Thoroughbred horse exhibited recurrent falls followed by convulsive seizures. The horse was clinically diagnosed with epilepsy and phenobarbital treatment was initiated. However, as seizure control was unsuccessful, the animal was euthanized. At necropsy, yellow-brown linear lesions were found extensively at the U-fibres and cingulate gyrus within the cerebral white matter. Histopathologically, linear demyelination and occasional cavitation were observed. Glial cells with yellow-brown pigment granules, which were autofluorescent, positive to the periodic acid-Schiff reaction ...
Ellero N, Lanci A, Avallone G, Mariella J, Castagnetti C, Muscatello LV, Di Maio C, Freccero F.Seizures, coma and death rapidly appeared after admission in a one ‑month‑old foal with a history of lethargy, fever and anorexia. Severe icterus and necrotizing hepatitis were observed at necropsy. Clinical signs, laboratory and postmortem findings were compatible with a suspect of clostridial hepatitis. Tyzzer’s disease was confirmed by the presence of organisms morphologically consistent with Clostridium piliforme in the hepatocytes at the margins of multiple areas of hepatic necrosis. To the authors’ knowledge, this is the first reported case of clostridial hepatitis caused by Clos...
Khusro A, Aarti C, Buendía-Rodriguez G, Arasu MV, Al-Dhabi NA, Barbabosa-Pliego A.Antibiotics-based therapy plays a paramount role in equine medicine because of their potential pharmacokinetics and pharmacodynamics properties. Conventional antibiotics show bacteriostatic and bactericidal properties by interfering bacterial cell wall and protein synthesis as well as inhibiting RNA polymerase, DNase 1, and DNA gyrase. Antibiotics are extensively used not only for the treatment of varied bacterial infections but also the prevention of postoperative and secondary infections. Surprisingly, antibiotics such as sulfonamides or trimethoprim/sulfonamide combinations, benzylpenicilli...
Rivas VN, Magdesian KG, Fagan S, Slovis NM, Luethy D, Javsicas LH, Caserto BG, Miller AD, Dahlgren AR, Peterson J, Hales EN, Peng S, Watson KD....Idiopathic hypocalcemia in Thoroughbred (TB) foals causes tetany and seizures and is invariably fatal. Based upon the similarity of this disease with human familial hypoparathyroidism and occurrence only in the TB breed, we conducted a genetic investigation on two affected TB foals. Familial hypoparathyroidism was identified, and pedigree analysis suggested an autosomal recessive (AR) mode of inheritance. We performed whole-genome sequencing of the two foals, their unaffected dams and four unaffected, unrelated TB horses. Both homozygosity mapping and an association analysis were used to prior...
Carrera JP, Pittí Y, Molares-Martínez JC, Casal E, Pereyra-Elias R, Saenz L, Guerrero I, Galué J, Rodriguez-Alvarez F, Jackman C, Pascale JM....Human cases of Madariaga virus (MADV) infection were first detected during an outbreak in 2010 in eastern Panama, where Venezuelan equine encephalitis virus (VEEV) also circulates. Little is known about the long-term consequences of either alphavirus infection. Methods: A follow-up study of the 2010 outbreak was undertaken in 2015. An additional survey was carried out 2 weeks after a separate 2017 alphavirus outbreak in a neighboring population in eastern Panama. Serological studies and statistical analyses were undertaken in both populations. Results: Among the originally alphavirus-seronegat...
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Aleman M, Costa LRR, Crowe C, Kass PH.Neuroglycopenia refers to a shortage of glucose in the brain resulting in neuronal dysfunction and death if left untreated. Presumed neuroglycopenia has not been described in horses. Objective: To report neurological signs in horses with presumed neuroglycopenia as the result of severe hypoglycemia. Methods: Ninety horses (hours to 28 years of age) diagnosed with hypoglycemia (blood glucose concentration < 75 mg/dL [< 4.2 mmol/L]). Methods: Retrospective study. Electronic medical records were searched. Signalment, history, complaint, clinical signs, laboratory findings including CSF analysis, ...
Mello GW, Riet-Correa F, Batista MC, Carvalho CJ, Dias AC, Franklin FL, Silva SM, Dias A.Farmers in the State of Piauí in northeastern Brazil reported nervous signs in ruminants and donkeys after ingestion of Brunfelsia uniflora at the start of the rainy season when the plant is flowering. Leaves of the plant, collected at the start or at the end of the rainy season, were administered in single doses of 5-20 g/kg body weight to 8 sheep and 3 donkeys. Two sheep and 1 donkey that ingested 10 g/kg of the plant in November at the start of the rainy season, when the plant was flowering, developed severe convulsions and diarrhea. One sheep was euthanized and autopsied, and no significa...
MacDonald KD, Hart KA, Davis JL, Berghaus LJ, Giguère S.Seizures are a common manifestation of neurological disease in the neonatal foal and are an important cause of morbidity and mortality in this population. Current antiepileptic options are effective, but often have undesirable adverse effects, short duration of action and high cost. Levetiracetam has an ideal safety and pharmacokinetic profile in multiple species, including the adult horse, and may be a safe and cost-effective alternative anticonvulsant in neonatal foals. Due to differences in drug disposition and clearance dosages in neonates, dosing recommendations in other species or adult ...
Aleman M, Finno CJ, Weich K, Penedo MCT.The carrier status of lavender foal syndrome (LFS), cerebellar abiotrophy (CA), severe combined immunodeficiency (SCID), and occipitoatlantoaxial malformation (OAAM1) in foals with juvenile idiopathic epilepsy (JIE) is unknown. Objective: To determine the carrier status of LFS, CA, SCID, and OAAM1 in foals with JIE. Methods: Ten foals with JIE. Methods: Archived DNA samples were tested for known genetic mutations causing LFS, CA, SCID, and OAAM1. The inclusion criteria consisted of having been diagnosed with JIE by ruling out other causes of seizures in foals and supported by electroencephalog...
Cesar FB, Stewart AJ, Boothe DM, Ravis WR, Duran SH, Wooldridge AA.Nine horses received 20 mg/kg of intravenous (LEV ); 30 mg/kg of intragastric, crushed immediate release (LEV ); and 30 mg/kg of intragastric, crushed extended release (LEV ) levetiracetam, in a three-way randomized crossover design. Crushed tablets were dissolved in water and administered by nasogastric tube. Serum samples were collected over 48 hr, and levetiracetam concentrations were determined by immunoassay. Mean ± SD peak concentrations for LEV and LEV were 50.72 ± 10.60 and 53.58 ± 15.94 μg/ml, respectively. The y-intercept for IV administration was 64.54 ± 24.99 μg...
Bak EJ, Jean YH, Woo GH.Four thoroughbred horses showing lameness, ataxia, circling, depression, recumbency, and seizures, were examined. The horses had gross, pale- to dark-red manifestations and foci in the central nervous system (CNS). Multifocal to coalescing eosinophilic necrotizing encephalomyelitis was observed histologically in the CNS along with intact or degenerated nematodes. Nematodes had polymyarian-coelomyarian musculature, a smooth thin cuticle, and intestines lined by multinucleated cells with microvilli. These traits suggested the nematodes belonged to the family Protostrongylidae, which includes Par...
Collins NM, Axon JE, Carrick JB, Russell CM, Palmer JE.To evaluate severe hyponatraemia in foals presenting as medical emergencies to an intensive care unit (ICU) in order to determine the prevalence, clinical findings, primary diagnosis and outcome. Methods: Retrospective case study of records from Thoroughbred foals aged less than 3 months presenting to an ICU as medical emergencies in 2002-12; foals with severe hyponatraemia (serum sodium <122 mmol/L) on admission laboratory data were identified. Data retrieved included signalment, clinical findings, laboratory results, primary diagnosis, treatment and outcome. Results: Severe hyponatraemia w...
Lyle-Dugas J, Giguère S, Mallicote MF, Mackay RJ, Sanchez LC.Neonatal encephalopathy is the most common neurological abnormality identified in neonatal foals, but its clinical course has been rarely characterised. Objective: To describe factors associated with nonsurvival in a population of foals diagnosed with neonatal encephalopathy. Methods: Retrospective cross-sectional clinical study. Methods: Cases were selected from equine neonatal (≤14 days of age) admissions between 1996 and 2007. Multivariable logistic regression was used to identify clinical parameters, laboratory variables and therapeutic interventions associated with nonsurvival. Results:...
Lacombe VA.Seizures are a diverse and very common set of chronic neurologic disorders in humans and dogs but are less common in horses. Seizures refer to a specific clinical event (described as sudden and severe) regardless of the etiology, which includes both intracranial and extracranial causes. Therefore, after briefly reviewing some definitions, this article aims to describe the use of a standardized classification, which could facilitate a logical approach for the clinician to establish a diagnosis, as well as to use a consistent mode of communication. For instance, seizures can be classified by typ...
Hardefeldt LY.Four neonatal foals were presented, over a 2-year period, (2011-2012) with aimlessly walking, head pressing, 'chewing gum' seizures and ataxia. The neurological lesion was consistent with increased intracranial pressure in all cases. All foals had severe hyponatraemia and azotaemia identified on biochemistry. Hyponatraemia was transient in 3/4 cases, with the foal in the final case requiring long-term sodium supplementation. Three foals survived to hospital discharge; one was euthanased because of anuric renal failure and one of the surviving foals was euthanased with septic osteomyelitis 2 we...
Bingham J, Payne J, Harper J, Frazer L, Eastwood S, Wilson S, Lowther S, Lunt R, Warner S, Carr M, Hall RA, Durr PA.West Nile virus (WNV; family Flaviviridae; genus Flavivirus) group members are an important cause of viral meningoencephalitis in some areas of the world. They exhibit marked variation in pathogenicity, with some viral lineages (such as those from North America) causing high prevalence of severe neurological disease, whilst others (such as Australian Kunjin virus) rarely cause disease. The aim of this study was to characterize WNV disease in a mouse model and to elucidate the pathogenetic features that distinguish disease variation. Tenfold dilutions of five WNV strains (New York 1999, MRM16 a...
Lacombe VA, Mayes M, Mosseri S, Reed SM, Ou TH.Although many studies have been performed to classify seizures by type in man and small animals, a similar study in horses is lacking. Objective: The aims of this study were as follows: 1) to characterise the distribution of seizure types in 104 horses presented for seizure disorders to a referral veterinary hospital; and 2) to characterise the various types of seizures by identifying associated clinical factors. Methods: Retrospective analysis of clinical records. Methods: Seizures were classified based on seizure type, according to the most recent accepted definitions in both human and small...
Swerczek TW.Reports of 148 cases of Tyzzer's disease in foals in central Kentucky were analyzed to identify features of the disease and factors associated with it. The records indicate that Tyzzer's disease is a rapidly progressive, highly fatal hepatitis caused by Clostridium piliforme. Common clinical findings are lethargy, fever, anorexia, and icterus. Seizures, coma, and death may rapidly ensue. Laboratory findings are leukopenia, metabolic acidosis, hypoglycemia, and increased activity of hepatic enzymes. Diagnosis is primarily based on clinical signs and postmortem findings but a polymerase chain re...
Wijnberg ID, van der Ree M, van Someren P.Short-duration electroencephalography (EEG) recordings in horses are helpful in diagnosing intracranial disorders. Potentially, long-duration ambulatory EEG (AEEG) recordings in horses will enhance the chance of detecting abnormal brain activity independent of the presence of an insult. Objective: The objective of this study was to test if AEEG recordings in unsedated horses can be acquired and benefit diagnosing abnormal brain activity. Methods: Recordings were taken from 8 adult control horses and 10 patients suspected of intracranial abnormalities. Self-adhesive electrodes and the 'Porti-5'...
Wendell LC, Potter NS, Roth JL, Salloway SP, Thompson BB.Eastern Equine Encephalitis (EEE) virus is an arbovirus that mostly causes asymptomatic infection in humans; however, some people can develop a neuroinvasive infection associated with a high mortality. Methods: We present a case of a patient with severe neuroinvasive EEE. Results: A 21-year-old man initially presented with headache, fever, and vomiting and was found to have a neutrophilic pleocytosis in his cerebrospinal fluid. He eventually was diagnosed with EEE, treated with high-dose methylprednisolone and intravenous immunoglobulin. His course in the NeuroIntensive Care Unit was complicat...
Di Cesare F, Negro V, Ravasio G, Villa R, Draghi S, Cagnardi P.Gabapentin is an anticonvulsant drug, which presents an established clinical efficacy in human patients for the management of refractory partial seizures, secondarily generalized tonic-clonic seizures, and for the control of chronic neuropathic pain. Gabapentin was synthesized as a structural analogue of the inhibitory neurotransmitter GABA, with GABA-mimetic effects, able to cross the blood-brain barrier. In veterinary medicine, is extra-label used in combination with other treatments to control seizures when other drugs are no longer effective or become toxic or for neuropathic pain treatmen...
Kinde H, Mathews M, Ash L, St Leger J.Two horses, a 16-year-old male Holsteiner and a 5-year-old male miniature horse, were diagnosed with halicephalobiasis at the California Veterinary Diagnostic Laboratory System, San Bernardino Branch, in April and June of 1998. Over a period of 4 weeks, the Holsteiner horse developed renal dysfunction, blepharospasm, and blindness in the right eye. A 15-cm-diameter mass was detected on ultrasound examination in the right kidney. Terminally, the animal developed seizures and was euthanized. The miniature horse had a 6-week-long illness characterized by testicular enlargement and uveitis. This a...
Carrera JP, Pittí Y, Molares-Martínez JC, Casal E, Pereyra-Elias R, Saenz L, Guerrero I, Galué J, Rodriguez-Alvarez F, Jackman C, Pascale JM....Human cases of Madariaga virus (MADV) infection were first detected during an outbreak in 2010 in eastern Panama, where Venezuelan equine encephalitis virus (VEEV) also circulates. Little is known about the long-term consequences of either alphavirus infection. Methods: A follow-up study of the 2010 outbreak was undertaken in 2015. An additional survey was carried out 2 weeks after a separate 2017 alphavirus outbreak in a neighboring population in eastern Panama. Serological studies and statistical analyses were undertaken in both populations. Results: Among the originally alphavirus-seronegat...
Lacombe VA, Mayes M, Mosseri S, Reed SM, Fenner WR, Ou HT.In contrast with reports in man and small animals, a systematic classification of seizures in horses is lacking. Objective: The purpose of this study was to classify seizures based on their aetiology and to characterise epilepsy in 104 horses presented for seizures at the Ohio State University Veterinary Medical Center between 1988 and 2009. Methods: In a retrospective observational study, seizures were classified by aetiology based on history, clinical observations, diagnostic investigations (e.g. electroencephalograms, cerebrospinal fluid and computed tomography imaging of the head) and post...
Bryant UK, Lyons ET, Bain FT, Hong CB.A 13-week-old Thoroughbred colt from central Kentucky was euthanized after an acute onset of ataxia, blindness, head tremors, leaning to the right, recumbency, and seizures. Microscopically, there was a verminous meningoencephalitis characterized by an eosinophilic and granulomatous inflammatory reaction primarily affecting the cerebellum. Dispersed within regions of inflammation were numerous cross and longitudinal sections of intact and degenerative small nematodes. The nematodes had dorsoflexed ovaries and ventroflexed vulvas, which are distinguishing features of Halicephalobus gingivalis. ...
Episodic collapse in horses has equine welfare and human safety implications. There are, however, no published case series describing this syndrome. Objective: To characterize the cause and outcomes for horses referred for investigation of episodic collapse. Methods: Twenty-five horses referred for investigation of single or multiple episodes of collapse. Methods: Retrospective study. Clinical records from the Dick Vet Equine Hospital, University of Edinburgh from November 1995 to July 2009 were searched using the following keywords: collapse, collapsing, fall, syncope. Collapse was defined as...
Swerczek TW.Reports of 148 cases of Tyzzer's disease in foals in central Kentucky were analyzed to identify features of the disease and factors associated with it. The records indicate that Tyzzer's disease is a rapidly progressive, highly fatal hepatitis caused by Clostridium piliforme. Common clinical findings are lethargy, fever, anorexia, and icterus. Seizures, coma, and death may rapidly ensue. Laboratory findings are leukopenia, metabolic acidosis, hypoglycemia, and increased activity of hepatic enzymes. Diagnosis is primarily based on clinical signs and postmortem findings but a polymerase chain re...
Hubbell JA, Kelly EM, Aarnes TK, Bednarski RM, Lerche P, Liu Z, Lakritz J.Midazolam is used to control seizures in horses and to enhance muscle relaxation, but its pharmacokinetics are unknown. Objective: To determine the pharmacokinetics and sedative effects of midazolam in horses. Methods: Blinded, randomised, crossover design. Methods: Midazolam was administered i.v. at either 0.05 or 0.1 mg/kg bwt to 6 horses on 2 occasions at least 7 days apart using a crossover design. Blood samples were collected before and at predetermined times through 24 h after administration. Serum midazolam concentrations were determined by a liquid chromatography tandem-mass spectromet...
Khusro A, Aarti C, Buendía-Rodriguez G, Arasu MV, Al-Dhabi NA, Barbabosa-Pliego A.Antibiotics-based therapy plays a paramount role in equine medicine because of their potential pharmacokinetics and pharmacodynamics properties. Conventional antibiotics show bacteriostatic and bactericidal properties by interfering bacterial cell wall and protein synthesis as well as inhibiting RNA polymerase, DNase 1, and DNA gyrase. Antibiotics are extensively used not only for the treatment of varied bacterial infections but also the prevention of postoperative and secondary infections. Surprisingly, antibiotics such as sulfonamides or trimethoprim/sulfonamide combinations, benzylpenicilli...
Lacombe VA, Podell M, Furr M, Reed SM, Oglesbee MJ, Hinchcliff KW, Kohn CW.Electroencephalography (EEG) is a valuable diagnostic test to identify functional disturbances in brain activity. The purpose of this study was to assess the validity of EEG as a diagnostic indicator of intracranial diseases in horses. The validity of EEG was estimated by comparing clinical, clinicopathologic, and histopathologic findings to EEG findings in 20 horses examined for seizures. collapse, or abnormal behavior between 1984 and 1997. A bipolar left-to-right, back-to-front montage and a bipolar circular montage were recorded from sedated (4) and anesthetized (16) horses. Visual and sem...
Pellegrini-Masini A, Bentz AI, Johns IC, Parsons CS, Beech J, Whitlock RH, Flaminio MJ.Three adult horses were evaluated for signs of musculoskeletal pain, dullness, ataxia, and seizures. A diagnosis of bacterial meningitis was made on the basis of results of CSF analysis. Because primary bacterial meningitis is so rare in adult horses without any history of generalized sepsis or trauma, immune function testing was pursued. Flow cytometric phenotyping of peripheral blood lymphocytes was performed, and proliferation of peripheral blood lymphocytes in response to concanavalin A, phytohemagglutinin, pokeweed mitogen, and lipopolysaccharide was determined. Serum IgA, IgM, and IgG co...
Lyle-Dugas J, Giguère S, Mallicote MF, Mackay RJ, Sanchez LC.Neonatal encephalopathy is the most common neurological abnormality identified in neonatal foals, but its clinical course has been rarely characterised. Objective: To describe factors associated with nonsurvival in a population of foals diagnosed with neonatal encephalopathy. Methods: Retrospective cross-sectional clinical study. Methods: Cases were selected from equine neonatal (≤14 days of age) admissions between 1996 and 2007. Multivariable logistic regression was used to identify clinical parameters, laboratory variables and therapeutic interventions associated with nonsurvival. Results:...
Wijnberg ID, van der Ree M, van Someren P.Short-duration electroencephalography (EEG) recordings in horses are helpful in diagnosing intracranial disorders. Potentially, long-duration ambulatory EEG (AEEG) recordings in horses will enhance the chance of detecting abnormal brain activity independent of the presence of an insult. Objective: The objective of this study was to test if AEEG recordings in unsedated horses can be acquired and benefit diagnosing abnormal brain activity. Methods: Recordings were taken from 8 adult control horses and 10 patients suspected of intracranial abnormalities. Self-adhesive electrodes and the 'Porti-5'...
Bingham J, Payne J, Harper J, Frazer L, Eastwood S, Wilson S, Lowther S, Lunt R, Warner S, Carr M, Hall RA, Durr PA.West Nile virus (WNV; family Flaviviridae; genus Flavivirus) group members are an important cause of viral meningoencephalitis in some areas of the world. They exhibit marked variation in pathogenicity, with some viral lineages (such as those from North America) causing high prevalence of severe neurological disease, whilst others (such as Australian Kunjin virus) rarely cause disease. The aim of this study was to characterize WNV disease in a mouse model and to elucidate the pathogenetic features that distinguish disease variation. Tenfold dilutions of five WNV strains (New York 1999, MRM16 a...
Spissu N, Panichi G, Montisci A, Fiore F.West Nile Virus (WNV) is an enveloped, positive-sense RNA virus belonging to the genus Flavivirus, antigenically related to the Japanese encephalitis complex in the family Flaviviridae. The principal vectors are mosquitoes, in particular Culex spp, and virus amplification seems to occur in susceptible birds that are the principal vertebrate reservoir hosts, whereas humans, horses and other vertebrates are considered incidental or dead-end hosts. The first Italian equine outbreak was reported in late summer of 1998 in Tuscany, in the area surrounding the Fucecchio marshes, where 14 clinical cas...
Sogaro-Robinson C, Lacombe VA, Reed SM, Balkrishnan R.To determine neurologic indications associated with abnormal results for computed tomography (CT) imaging of the head of horses affected by neurologic disorders. Methods: Retrospective case series. Methods: 57 horses. Methods: Signalment, history, clinical abnormalities, and clinicopathologic findings were obtained from medical records of horses examined because of neurologic disorders, and precontrast and postcontrast CT images of the head were reviewed. Data were analyzed by use of univariate and multivariate logistic regression. Results: For a horse with abnormal mentation, odds of having a...
Aleman M, Finno CJ, Weich K, Penedo MCT.The carrier status of lavender foal syndrome (LFS), cerebellar abiotrophy (CA), severe combined immunodeficiency (SCID), and occipitoatlantoaxial malformation (OAAM1) in foals with juvenile idiopathic epilepsy (JIE) is unknown. Objective: To determine the carrier status of LFS, CA, SCID, and OAAM1 in foals with JIE. Methods: Ten foals with JIE. Methods: Archived DNA samples were tested for known genetic mutations causing LFS, CA, SCID, and OAAM1. The inclusion criteria consisted of having been diagnosed with JIE by ruling out other causes of seizures in foals and supported by electroencephalog...
Green SL, Little CB, Baird JD, Tremblay RR, Smith-Maxie LL.The case records of 20 horses with tetanus referred to the Ontario Veterinary College-Veterinary Teaching Hospital between 1970 and 1990 were reviewed. The fatality rate was 75%. There was a strong association with previous vaccination and survival (P = .03). Most of the animals had been injured an average of 9 days (range 2 to 21 days) prior to development of clinical signs. Hyperesthesia and prolapse of the third eyelid were the most common clinical signs. Treatment regimens varied during hospitalization; however, all horses received parenteral penicillin, tranquilizers, tetanus toxoid, and ...
Couëtil LL, Hoffman AM.A 3-day-old female Pinto was admitted with profuse watery diarrhea and severe hypovolemic shock. After 1 week of intensive care, the foal developed seizures associated with profound serum electrolyte abnormalities suggestive of hypoadrenocorticism. Treatment with prednisone and isotonic saline (0.9% NaCl) solution led to prompt clinical response. Premature withdrawal of prednisone resulted in relapse of clinical signs. A diagnosis of adrenal insufficiency was made on the basis of clinical signs, electrolyte abnormalities, low baseline cortisol concentration, and lack of response to administrat...
Jackson CA, deLahunta A, Dykes NL, Divers TJ.Cholesterinic granulomas have been previously reported as an incidental post mortem in horses. Three adult horses with diencephalic dysfunction due to cholesterinic granulomas are described. All the horses exhibited profound depression, somnolence and reluctance to move. One horse experienced generalised seizures. Cerebrosinal fluid was xanthochromic with an elevated total protein in two of the cases evaluated. The large cholesterinic granulomas caused expansion of the lateral ventricle and secondary hydrocephalus due to the build up of cerebrospinal fluid behind the mass. Cholesterinic granul...
Aleman M, Costa LRR, Crowe C, Kass PH.Neuroglycopenia refers to a shortage of glucose in the brain resulting in neuronal dysfunction and death if left untreated. Presumed neuroglycopenia has not been described in horses. Objective: To report neurological signs in horses with presumed neuroglycopenia as the result of severe hypoglycemia. Methods: Ninety horses (hours to 28 years of age) diagnosed with hypoglycemia (blood glucose concentration < 75 mg/dL [< 4.2 mmol/L]). Methods: Retrospective study. Electronic medical records were searched. Signalment, history, complaint, clinical signs, laboratory findings including CSF analysis, ...
McEntee M, Summers BA, de Lahunta A, Cummings J.A 3-year-old horse presented with intermittent generalized seizures of 2-month duration. During interictal periods, the horse appeared normal and a cause for the seizures could not be identified. Necropsy revealed opacity of the leptomeninges, covering most of one cerebral hemisphere along with thinning and collapse of the cortex in the ipsilateral pyriform lobe. Histopathology demonstrated leptomeningeal vascular proliferation and meningothelial hyperplasia. Prominent tortuous vessels of the gyri and sulci extended into some regions of the subjacent cortex, where there was neuronal loss, ecto...
Wong D, Hepworth K, Yaeger M, Miles K, Wilgenbusch C.An 8-year-old Thoroughbred mare presented for decreased appetite, ataxia, and weakness. Abdominal ultrasound revealed a large volume of anechoic fluid along with multiple masses involving the spleen, liver, and diaphragm. Pleural fluid was identified via ultrasonography and thoracic radiography. Thoracic radiographs also identified pulmonary interstitial nodules, an undulant dorsal diaphragmatic margin and enlargement of tracheobronchial lymph nodes. Clinical signs of weakness and mild seizures were concurrent with hypoglycemic episodes. The final diagnosis was cholangiocarcinoma with extensiv...
Lichter-Peled A, Polani S, Stanyon R, Rocchi M, Kahila Bar-Gal G.Juvenile idiopathic epilepsy (JIE) in Arabian foals resembles benign-familial neonatal convulsion (BFNC) syndrome, a rare idiopathic epilepsy of new-born humans. BFNC syndrome exhibits genetic heterogeneity, as has been hypothesised to occur in Arabian foals, and is known to be caused by mutations in the voltage-gated potassium channel subunit KCNQ2 and KCNQ3 genes. The close phenotypic characteristics of both Arabian foals and children suggest these epileptic syndromes are caused by the same genetic disorder. In horses, the KCNQ2 and KCNQ3 genes are located on the terminal region of chromosom...
Beyer MJ, Freestone JF, Reimer JM, Bernard WV, Rueve ER.Five thoroughbred foals (4 fillies and 1 colt), all in good to excellent body condition, ranging in age from 4 days to 5 weeks at the time of onset of signs, were presented to 2 Kentucky equine hospitals from 1992 through 1996. All 5 foals presented with tachycardia, hyperhidrosis, diarrhea or a recent history of diarrhea, and muscle rigidity or stiff gait. Four of the 5 foals presented for recumbency, seizure-like activity with opisthotonos, or pronounced extensor muscle rigidity. All 5 foals were hypocalcemic. All foals either died or had euthanasia performed. None responded to oral calcium ...
van der Ree M, Wijnberg I.Epilepsy in the horse is diagnosed based on clinical signs, but diagnosing can be difficult if a grand mal is not present. The future prospects of the horse and potentially the safety of the owner depend on an accurate diagnosis. This review presents information on epilepsy and focuses on the diagnostic potential of (Ambulatory) electroencephalography ((A) EEG). An epileptic seizure is a brain disorder, which expresses itself as a recurrent episode of involuntary abnormal behaviour. The aetiology can originate from inside or outside the brain or is idiopathic. Besides those categories, seizure...
Galvin N, Collins D.: This report presented a brief overview of the literature on the perinatal asphyxia syndrome (PAS) in foals as a prelude to a description of the investigation and treatment of acute onset seizures in a 24-hour-old Thoroughbred colt foal.PAS can cause a wide variety of clinical abnormalities, of which seizures due to encephalopathy are the most significant. The structural and biochemical components of CNS neurones are disrupted by the shift from oxidative to anaerobic metabolism, with a resultant deficit in cellular energy. The cells succumb to the combined effects of acidosis, neurotoxic acti...
Wilson JW.Creatine phosphokinase activity was determined in cerebrospinal fluid samples submitted for analysis from 126 animals suspected of having central nervous system disease. Values less than 1 sigma unit/ml were obtained on 32 samples and values less than or equal to 1 sigma unit/ml were obtained on 94 samples. The creatine phosphokinase values were increased in all cases of feline toxoplasmosis and feline infectious peritonitis. From other cases, especially seizure disorders and suspected poisonings, and apparent aid in prognosis for future cases was identified.
Polani S, Dean M, Lichter-Peled A, Hendrickson S, Tsang S, Fang X, Feng Y, Qiao W, Avni G, Kahila Bar-Gal G.Juvenile idiopathic epilepsy (JIE) is a self-limiting neurological disorder with a suspected genetic predisposition affecting young Arabian foals of the Egyptian lineage. The condition is characterized by tonic-clonic seizures with intermittent post-ictal blindness, in which most incidents are sporadic and unrecognized. This study aimed to identify genetic components shared across a local cohort of Arabian foals diagnosed with JIE via a combined whole genome and targeted resequencing approach: Initial whole genome comparisons between a small cohort of nine diagnosed foals (cases) and 27 contro...
