Seizures in horses are neurological events characterized by sudden, uncontrolled electrical disturbances in the brain. These episodes can manifest as changes in behavior, motor activity, or consciousness and may vary in duration and severity. The underlying causes of seizures in horses can include genetic predispositions, metabolic disorders, infections, or traumatic brain injuries. Diagnosis often involves a combination of clinical examination, neurological assessment, and diagnostic imaging. This topic encompasses peer-reviewed research studies and scholarly articles that explore the etiology, pathophysiology, diagnostic approaches, and management strategies for seizures in equine patients.
Wijnberg ID, van der Ree M, van Someren P.Short-duration electroencephalography (EEG) recordings in horses are helpful in diagnosing intracranial disorders. Potentially, long-duration ambulatory EEG (AEEG) recordings in horses will enhance the chance of detecting abnormal brain activity independent of the presence of an insult. Objective: The objective of this study was to test if AEEG recordings in unsedated horses can be acquired and benefit diagnosing abnormal brain activity. Methods: Recordings were taken from 8 adult control horses and 10 patients suspected of intracranial abnormalities. Self-adhesive electrodes and the 'Porti-5'...
Wong D, Hepworth K, Yaeger M, Miles K, Wilgenbusch C.An 8-year-old Thoroughbred mare presented for decreased appetite, ataxia, and weakness. Abdominal ultrasound revealed a large volume of anechoic fluid along with multiple masses involving the spleen, liver, and diaphragm. Pleural fluid was identified via ultrasonography and thoracic radiography. Thoracic radiographs also identified pulmonary interstitial nodules, an undulant dorsal diaphragmatic margin and enlargement of tracheobronchial lymph nodes. Clinical signs of weakness and mild seizures were concurrent with hypoglycemic episodes. The final diagnosis was cholangiocarcinoma with extensiv...
Wendell LC, Potter NS, Roth JL, Salloway SP, Thompson BB.Eastern Equine Encephalitis (EEE) virus is an arbovirus that mostly causes asymptomatic infection in humans; however, some people can develop a neuroinvasive infection associated with a high mortality. Methods: We present a case of a patient with severe neuroinvasive EEE. Results: A 21-year-old man initially presented with headache, fever, and vomiting and was found to have a neutrophilic pleocytosis in his cerebrospinal fluid. He eventually was diagnosed with EEE, treated with high-dose methylprednisolone and intravenous immunoglobulin. His course in the NeuroIntensive Care Unit was complicat...
Hubbell JA, Kelly EM, Aarnes TK, Bednarski RM, Lerche P, Liu Z, Lakritz J.Midazolam is used to control seizures in horses and to enhance muscle relaxation, but its pharmacokinetics are unknown. Objective: To determine the pharmacokinetics and sedative effects of midazolam in horses. Methods: Blinded, randomised, crossover design. Methods: Midazolam was administered i.v. at either 0.05 or 0.1 mg/kg bwt to 6 horses on 2 occasions at least 7 days apart using a crossover design. Blood samples were collected before and at predetermined times through 24 h after administration. Serum midazolam concentrations were determined by a liquid chromatography tandem-mass spectromet...
Spissu N, Panichi G, Montisci A, Fiore F.West Nile Virus (WNV) is an enveloped, positive-sense RNA virus belonging to the genus Flavivirus, antigenically related to the Japanese encephalitis complex in the family Flaviviridae. The principal vectors are mosquitoes, in particular Culex spp, and virus amplification seems to occur in susceptible birds that are the principal vertebrate reservoir hosts, whereas humans, horses and other vertebrates are considered incidental or dead-end hosts. The first Italian equine outbreak was reported in late summer of 1998 in Tuscany, in the area surrounding the Fucecchio marshes, where 14 clinical cas...
Lichter-Peled A, Polani S, Stanyon R, Rocchi M, Kahila Bar-Gal G.Juvenile idiopathic epilepsy (JIE) in Arabian foals resembles benign-familial neonatal convulsion (BFNC) syndrome, a rare idiopathic epilepsy of new-born humans. BFNC syndrome exhibits genetic heterogeneity, as has been hypothesised to occur in Arabian foals, and is known to be caused by mutations in the voltage-gated potassium channel subunit KCNQ2 and KCNQ3 genes. The close phenotypic characteristics of both Arabian foals and children suggest these epileptic syndromes are caused by the same genetic disorder. In horses, the KCNQ2 and KCNQ3 genes are located on the terminal region of chromosom...
van der Ree M, Wijnberg I.Epilepsy in the horse is diagnosed based on clinical signs, but diagnosing can be difficult if a grand mal is not present. The future prospects of the horse and potentially the safety of the owner depend on an accurate diagnosis. This review presents information on epilepsy and focuses on the diagnostic potential of (Ambulatory) electroencephalography ((A) EEG). An epileptic seizure is a brain disorder, which expresses itself as a recurrent episode of involuntary abnormal behaviour. The aetiology can originate from inside or outside the brain or is idiopathic. Besides those categories, seizure...
Lacombe VA, Mayes M, Mosseri S, Reed SM, Fenner WR, Ou HT.In contrast with reports in man and small animals, a systematic classification of seizures in horses is lacking. Objective: The purpose of this study was to classify seizures based on their aetiology and to characterise epilepsy in 104 horses presented for seizures at the Ohio State University Veterinary Medical Center between 1988 and 2009. Methods: In a retrospective observational study, seizures were classified by aetiology based on history, clinical observations, diagnostic investigations (e.g. electroencephalograms, cerebrospinal fluid and computed tomography imaging of the head) and post...
Wong D, Wilkins PA, Bain FT, Brockus C.Neonatal encephalopathy is a common central nervous system disorder of neonatal foals and human infants, resulting in clinical signs such as lethargy, inappropriate behavior, seizures, and other neurologic deficits. Although neonatal encephalopathy is frequently seen in equine practice, a paucity of veterinary clinical and basic science research data is available. Therefore, the pathophysiologic mechanisms of this disorder in equids, such as energy deprivation, excess excitatory amino acids, and free radical injury, have been extrapolated from human medicine. Equine veterinarians have used var...
Easterwood L, Chaffin MK, Marsh PS, Porter B, Barr C.66 horses were potentially exposed to phosphine (a gas) 14 hours after being fed a pelleted ration treated with aluminum phosphide. Results: 28 horses had clinical signs of profuse sweating, tachycardia, tachypnea, pyrexia, ataxia, seizures, and widespread muscle tremors. Clinically relevant laboratory findings included hypoglycemia and high plasma concentrations of lactate and ammonia and activities of gamma-glutamyl transpeptidase, aspartate aminotransferase, and alkaline phosphatase. At least 4 horses had signs consistent with hepatic encephalopathy. Necropsy findings included petechial and...
Sogaro-Robinson C, Lacombe VA, Reed SM, Balkrishnan R.To determine neurologic indications associated with abnormal results for computed tomography (CT) imaging of the head of horses affected by neurologic disorders. Methods: Retrospective case series. Methods: 57 horses. Methods: Signalment, history, clinical abnormalities, and clinicopathologic findings were obtained from medical records of horses examined because of neurologic disorders, and precontrast and postcontrast CT images of the head were reviewed. Data were analyzed by use of univariate and multivariate logistic regression. Results: For a horse with abnormal mentation, odds of having a...
Wilcox AL, Calise DV, Chapman SE, Edwards JF, Storts RW.Hypoxic/ischemic encephalopathy in a cloned American Quarter horse foal was initially associated with placental insufficiency and exacerbated by protracted hypotension during anesthesia for a surgical procedure. The foal, born at the Texas A&M Veterinary Medical Center, was diagnosed at birth with neonatal maladjustment syndrome that was accompanied by dysmaturity, muscle contracture of the front limbs, and a blood clot within the lumen of the urinary bladder. Seizures that developed after anesthesia were attributed to hypoxia/ischemia during anesthesia and culminated in death. Macroscopically...
Raidal SL, Edwards S.To determine the pharmacokinetics of potassium bromide (KBr) in horses after a single and multiple oral doses. Methods: Twelve adult Standardbred and Thoroughbred mares. Methods: Horses were randomly assigned into two treatment groups. In Part 1 of the study, horses were given a single oral dose of 120 mg/kg KBr. Part 2 of the study evaluated a loading dose of 120 mg/kg KBr daily by stomach tube for 5 days, followed by 40 mg/kg daily in feed for 7 days. Serum concentrations of bromide were determined by colorimetric spectrophotometry following drug administration to permit determination of con...
Dickinson CE, Gould DH, Davidson AH, Avery PR, Legare ME, Hyatt DR, DebRoy C.A postpartum mare and foal were presented for evaluation of fever and lethargy in the mare. The mare was diagnosed with endometritis and initially responded well to treatment. On the second day of hospitalization, the mare developed renal insufficiency characterized by oliguria, azotemia, hemolysis, and thrombocytopenia. Concurrently, the foal developed rapidly progressive central nervous system signs culminating in refractory seizures. Both animals failed to respond to treatment and were euthanized. Thrombotic microangiopathy involving glomeruli was evident on microscopic examination of the m...
Lehner AF, Stewart J, Dafalla A, Ely KJ, Connerly AL, Jones CN, ElkHoly H, Thompson K, Tobin T, Dirikolu L.Gabapentin [1-(aminomethyl)cyclohexaneacetic acid, Neurontin], is a new anticonvulsant used as adjunctive therapy in the treatment of partial seizures in humans not controlled with standard antiseizure drugs, and it has also been used in veterinary medicine. In performance horses, gabapentin is listed as a class 3 performance-enhancing substance by the Association of Racing Commissioners International, and thus is considered to have the potential to influence the outcome of races. Therefore, we developed and validated a sensitive gas chromatographic-mass spectrometric (GC-MS) method for gabape...
Loynachan AT, Williams NM, Freestone JF.A 5-day-old Thoroughbred foal was submitted to the necropsy service at the University of Kentucky Livestock Disease Diagnostic Center. The foal had a clinical history of seizure activity and severe icterus. A complete blood count and serum chemistry analysis indicated that the foal was anemic (hematocrit, 16%), hyperbilirubinemic (45 mg/dl), and hypoglycemic. At necropsy, all tissues were discolored various shades of yellow. Microscopically, there was degeneration and necrosis of cerebral neurons and cerebellar Purkinje cells; severe hepatocellular degeneration and necrosis; and deposition of ...
Bryant UK, Lyons ET, Bain FT, Hong CB.A 13-week-old Thoroughbred colt from central Kentucky was euthanized after an acute onset of ataxia, blindness, head tremors, leaning to the right, recumbency, and seizures. Microscopically, there was a verminous meningoencephalitis characterized by an eosinophilic and granulomatous inflammatory reaction primarily affecting the cerebellum. Dispersed within regions of inflammation were numerous cross and longitudinal sections of intact and degenerative small nematodes. The nematodes had dorsoflexed ovaries and ventroflexed vulvas, which are distinguishing features of Halicephalobus gingivalis. ...
Raidal SL, Edwards S.To determine the pharmacokinetics of potassium bromide (KBr) in horses after single and multiple oral doses. Methods: Twelve adult Standardbred and Thoroughbred mares. Methods: Horses were randomly assigned to two treatment groups. Group 1 horses were given a single oral dose of 120 mg/kg potassium bromide. Part 2 of the study evaluated a loading dose of 120 mg/kg KBr daily by stomach tube for 5 days, followed by 40 mg/kg daily in feed for 7 days. Serum concentrations of KBr were measured to construct concentration versus time curves and to calculate pharmacokinetic parameters. Treated horses ...
Pellegrini-Masini A, Bentz AI, Johns IC, Parsons CS, Beech J, Whitlock RH, Flaminio MJ.Three adult horses were evaluated for signs of musculoskeletal pain, dullness, ataxia, and seizures. A diagnosis of bacterial meningitis was made on the basis of results of CSF analysis. Because primary bacterial meningitis is so rare in adult horses without any history of generalized sepsis or trauma, immune function testing was pursued. Flow cytometric phenotyping of peripheral blood lymphocytes was performed, and proliferation of peripheral blood lymphocytes in response to concanavalin A, phytohemagglutinin, pokeweed mitogen, and lipopolysaccharide was determined. Serum IgA, IgM, and IgG co...
Galvin N, Collins D.: This report presented a brief overview of the literature on the perinatal asphyxia syndrome (PAS) in foals as a prelude to a description of the investigation and treatment of acute onset seizures in a 24-hour-old Thoroughbred colt foal.PAS can cause a wide variety of clinical abnormalities, of which seizures due to encephalopathy are the most significant. The structural and biochemical components of CNS neurones are disrupted by the shift from oxidative to anaerobic metabolism, with a resultant deficit in cellular energy. The cells succumb to the combined effects of acidosis, neurotoxic acti...
Fitzgerald SD, Braselton WE.Diagnostic evaluation of a mildly ataxic young gelding Quarterhorse included a contrast myelogram. Unfortunately, sodium diatrizoate was inappropriately administered by intrathecal injection resulting in severe unrelenting seizure activity and necessitated the destruction of the animal. The contrast agent was identified by analyzing cerebrospinal fluid by high-performance liquid chromatography and confirmed with probe mass spectrometric analysis. This contrast agent is highly ionic, has high osmolarity, and also blocks neurotransmission at specific receptors; for these reasons it is contraindi...
Khan SA, Kuster DA, Hansen SR.Moxidectin is a macrolide endectocide available as a 2% equine oral gel in the US. This report presents clinical signs of moxidectin toxicosis and its treatment in equines as reported to the ASPCA Animal Poison Control Center (APCC) from January 1998 to December 2000. Nine cases of moxidectin overdose in equines occurred: 5 had signs of toxicosis such as coma, dyspnea, depression, ataxia, tremors, seizures, or weakness. The approximate dose of moxidectin at which these signs were observed ranged from 1.0 to 5.1 mg/kg. The 4 equines that ingested moxidectin between 0.9 mg/kg to 1.7 mg/kg did no...
Lacombe VA, Podell M, Furr M, Reed SM, Oglesbee MJ, Hinchcliff KW, Kohn CW.Electroencephalography (EEG) is a valuable diagnostic test to identify functional disturbances in brain activity. The purpose of this study was to assess the validity of EEG as a diagnostic indicator of intracranial diseases in horses. The validity of EEG was estimated by comparing clinical, clinicopathologic, and histopathologic findings to EEG findings in 20 horses examined for seizures. collapse, or abnormal behavior between 1984 and 1997. A bipolar left-to-right, back-to-front montage and a bipolar circular montage were recorded from sedated (4) and anesthetized (16) horses. Visual and sem...
Kinde H, Mathews M, Ash L, St Leger J.Two horses, a 16-year-old male Holsteiner and a 5-year-old male miniature horse, were diagnosed with halicephalobiasis at the California Veterinary Diagnostic Laboratory System, San Bernardino Branch, in April and June of 1998. Over a period of 4 weeks, the Holsteiner horse developed renal dysfunction, blepharospasm, and blindness in the right eye. A 15-cm-diameter mass was detected on ultrasound examination in the right kidney. Terminally, the animal developed seizures and was euthanized. The miniature horse had a 6-week-long illness characterized by testicular enlargement and uveitis. This a...
Feige K, Eser MW, Geissbühler U, Balestra E, Metzler K.Hirsutism was the most often observed symptom in horses with a pituitary gland tumor and was present in all 13 examined horses. Other symptoms were atrophy of muscles (n = 10), hyperhidrosis (n = 8), polyuria/polydipsia (n = 5), bulging or supraorbital fat (n = 3), polyphagia (n = 2), apathy (n = 2) and seizures (n = 2). Laminitis was the most frequently observed concurrent disease (n = 8). Hyperglycaemia (mean, 9.9 +/- 3.71 mmol/l) in 13 horses and glucosuria (median, 55 [range, 2-55] mmol/l) in 7 horses were the most important laboratory results. The dexamethasone suppression test was positi...
Couëtil LL, Hoffman AM.A 3-day-old female Pinto was admitted with profuse watery diarrhea and severe hypovolemic shock. After 1 week of intensive care, the foal developed seizures associated with profound serum electrolyte abnormalities suggestive of hypoadrenocorticism. Treatment with prednisone and isotonic saline (0.9% NaCl) solution led to prompt clinical response. Premature withdrawal of prednisone resulted in relapse of clinical signs. A diagnosis of adrenal insufficiency was made on the basis of clinical signs, electrolyte abnormalities, low baseline cortisol concentration, and lack of response to administrat...
Beyer MJ, Freestone JF, Reimer JM, Bernard WV, Rueve ER.Five thoroughbred foals (4 fillies and 1 colt), all in good to excellent body condition, ranging in age from 4 days to 5 weeks at the time of onset of signs, were presented to 2 Kentucky equine hospitals from 1992 through 1996. All 5 foals presented with tachycardia, hyperhidrosis, diarrhea or a recent history of diarrhea, and muscle rigidity or stiff gait. Four of the 5 foals presented for recumbency, seizure-like activity with opisthotonos, or pronounced extensor muscle rigidity. All 5 foals were hypocalcemic. All foals either died or had euthanasia performed. None responded to oral calcium ...
Rees WA, Harkins JD, Woods WE, Blouin RA, Lu M, Fenger C, Holland RE, Chambers TM, Tobin T.Amantadine is an antiviral agent effective against influenza A viruses. We investigated 1) the antiviral efficacy, 2) analytical detection, 3) bioavailability and disposition, 4) pharmacokinetic modelling and 5) adverse reactions of amantadine in the horse. In vitro, amantadine and its derivative rimantadine suppressed the replication of recent isolates of equine-2 influenza virus with effective doses (EDs) of less than 30 ng/ml. Rimantadine was more effective than amantadine against most viral isolates; we suggest a minimum plasma concentration of 300 ng/ml of amantadine for therapeutic effic...
Easton-Jones C, Woolard K, Mohr FC, Roy MA, Aleman M.Intracranial neoplasia in horses is rare compared to other species. Detailed information such as neurological, electroencephalographic, and histopathological examination of horses with intracranial neoplasia associated with seizures is scarce in the literature. Furthermore, ganglioglioma has not been reported in the horse. A 7-year-old Quarter horse cross Paint gelding was examined due to recurrent seizure-like episodes of 1-year duration. The seizures had been increasing in frequency and length, occurring up to 20 times a day at the time of presentation. Neurological examination revealed inte...
Khan SA, Kuster DA, Hansen SR.Moxidectin is a macrolide endectocide available as a 2% equine oral gel in the US. This report presents clinical signs of moxidectin toxicosis and its treatment in equines as reported to the ASPCA Animal Poison Control Center (APCC) from January 1998 to December 2000. Nine cases of moxidectin overdose in equines occurred: 5 had signs of toxicosis such as coma, dyspnea, depression, ataxia, tremors, seizures, or weakness. The approximate dose of moxidectin at which these signs were observed ranged from 1.0 to 5.1 mg/kg. The 4 equines that ingested moxidectin between 0.9 mg/kg to 1.7 mg/kg did no...
Rivas VN, Magdesian KG, Fagan S, Slovis NM, Luethy D, Javsicas LH, Caserto BG, Miller AD, Dahlgren AR, Peterson J, Hales EN, Peng S, Watson KD....Idiopathic hypocalcemia in Thoroughbred (TB) foals causes tetany and seizures and is invariably fatal. Based upon the similarity of this disease with human familial hypoparathyroidism and occurrence only in the TB breed, we conducted a genetic investigation on two affected TB foals. Familial hypoparathyroidism was identified, and pedigree analysis suggested an autosomal recessive (AR) mode of inheritance. We performed whole-genome sequencing of the two foals, their unaffected dams and four unaffected, unrelated TB horses. Both homozygosity mapping and an association analysis were used to prior...
Bak EJ, Jean YH, Woo GH.Four thoroughbred horses showing lameness, ataxia, circling, depression, recumbency, and seizures, were examined. The horses had gross, pale- to dark-red manifestations and foci in the central nervous system (CNS). Multifocal to coalescing eosinophilic necrotizing encephalomyelitis was observed histologically in the CNS along with intact or degenerated nematodes. Nematodes had polymyarian-coelomyarian musculature, a smooth thin cuticle, and intestines lined by multinucleated cells with microvilli. These traits suggested the nematodes belonged to the family Protostrongylidae, which includes Par...
Ross MW, Lowe JE, Cooper BJ, Reimers TJ, Froscher BA.A 12-year-old, 195 kg Shetland pony broodmare had eight seizures between May 29 and August 7, 1979. Plasma glucose levels during three of these seizures were markedly depressed (16, 18 and 19 mg/100 ml). Serum insulin levels were elevated during two of the seizures (86.0 and 97.7 microU/ml). Although a fasting hypoglycemia was not demonstrated, plasma glucose values during a normal day were abnormal; a plasma glucose level of 42 mg/100 ml was noted eight hours post-feeding. Serum insulin values obtained during an oral glucose tolerance test and intravenous glucagon tolerance test were consiste...
Raidal SL, Edwards S.To determine the pharmacokinetics of potassium bromide (KBr) in horses after a single and multiple oral doses. Methods: Twelve adult Standardbred and Thoroughbred mares. Methods: Horses were randomly assigned into two treatment groups. In Part 1 of the study, horses were given a single oral dose of 120 mg/kg KBr. Part 2 of the study evaluated a loading dose of 120 mg/kg KBr daily by stomach tube for 5 days, followed by 40 mg/kg daily in feed for 7 days. Serum concentrations of bromide were determined by colorimetric spectrophotometry following drug administration to permit determination of con...
Spehar AM, Hill MR, Mayhew IG, Hendeles L.Pharmacokinetic characteristics of the anticonvulsant phenobarbital were studied in seven pony and two Thoroughbred foals aged between four and 10 days. A single, 20 mg/kg bodyweight (bwt) dose of phenobarbital was given intravenously over 25 mins and the serum concentrations of the drug were measured using an EMIT AED assay (coefficient of variation 1.37 per cent at 30 micrograms/ml, n = 7). Phenobarbital elimination was found to follow first order kinetics. The mean (+/- sd) peak phenobarbital serum concentration was 18.6 +/- 2.1 micrograms/ml at 1 h after initiation of infusion with a mean ...
Lavy E, Ziv G, Glickman A.An aqueous solution of norfloxacin nicotinate (NFN) was administered to donkeys (Aquus asinus) intravenously (once at 10 mg/kg), intramuscularly and orally (both routes once at 10 and 20 mg/kg, and for 5 days at 20 mg/kg/day). Blood samples were collected at predetermined times after each treatment and urine was sampled after intravenous drug administration. Serum NFN concentrations were determined by microbiological assay. Intravenous injection of NFN over 45-60 s resulted in seizures, profuse sweating and tachycardia. The intravenous half-life (t1/2 beta) was 209 +/- 36 min, the apparent vol...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Dickinson CE, Gould DH, Davidson AH, Avery PR, Legare ME, Hyatt DR, DebRoy C.A postpartum mare and foal were presented for evaluation of fever and lethargy in the mare. The mare was diagnosed with endometritis and initially responded well to treatment. On the second day of hospitalization, the mare developed renal insufficiency characterized by oliguria, azotemia, hemolysis, and thrombocytopenia. Concurrently, the foal developed rapidly progressive central nervous system signs culminating in refractory seizures. Both animals failed to respond to treatment and were euthanized. Thrombotic microangiopathy involving glomeruli was evident on microscopic examination of the m...
Lakritz J, Madigan J, Carlson GP.Hypovolemic hyponatremia attributable to severe fluid and electrolyte alterations was diagnosed in a foal with diarrhea. Subsequent consumption of water resulted in rapid reduction of serum sodium concentration and serum osmolar depression. Clinical signs of neurologic disease developed including blindness, loss of menace response, and seizures. Treatment of this condition with IV administered fluids included hypertonic saline solution (7.2%; 2 ml/kg of body weight), and frequent monitoring of serum electrolyte concentrations and osmolality resulted in gradual correction of the fluid and elect...
Collins NM, Axon JE, Carrick JB, Russell CM, Palmer JE.To evaluate severe hyponatraemia in foals presenting as medical emergencies to an intensive care unit (ICU) in order to determine the prevalence, clinical findings, primary diagnosis and outcome. Methods: Retrospective case study of records from Thoroughbred foals aged less than 3 months presenting to an ICU as medical emergencies in 2002-12; foals with severe hyponatraemia (serum sodium <122 mmol/L) on admission laboratory data were identified. Data retrieved included signalment, clinical findings, laboratory results, primary diagnosis, treatment and outcome. Results: Severe hyponatraemia w...
Wong D, Wilkins PA, Bain FT, Brockus C.Neonatal encephalopathy is a common central nervous system disorder of neonatal foals and human infants, resulting in clinical signs such as lethargy, inappropriate behavior, seizures, and other neurologic deficits. Although neonatal encephalopathy is frequently seen in equine practice, a paucity of veterinary clinical and basic science research data is available. Therefore, the pathophysiologic mechanisms of this disorder in equids, such as energy deprivation, excess excitatory amino acids, and free radical injury, have been extrapolated from human medicine. Equine veterinarians have used var...
Easterwood L, Chaffin MK, Marsh PS, Porter B, Barr C.66 horses were potentially exposed to phosphine (a gas) 14 hours after being fed a pelleted ration treated with aluminum phosphide. Results: 28 horses had clinical signs of profuse sweating, tachycardia, tachypnea, pyrexia, ataxia, seizures, and widespread muscle tremors. Clinically relevant laboratory findings included hypoglycemia and high plasma concentrations of lactate and ammonia and activities of gamma-glutamyl transpeptidase, aspartate aminotransferase, and alkaline phosphatase. At least 4 horses had signs consistent with hepatic encephalopathy. Necropsy findings included petechial and...
Lacombe VA, Mayes M, Mosseri S, Reed SM, Ou TH.Although many studies have been performed to classify seizures by type in man and small animals, a similar study in horses is lacking. Objective: The aims of this study were as follows: 1) to characterise the distribution of seizure types in 104 horses presented for seizure disorders to a referral veterinary hospital; and 2) to characterise the various types of seizures by identifying associated clinical factors. Methods: Retrospective analysis of clinical records. Methods: Seizures were classified based on seizure type, according to the most recent accepted definitions in both human and small...
Mount ME, Feldman BF.Strychnine toxicosis is characterized by inducible tetanic seizures and metaldehyde poisoning by fine fasciculations progressing to generalized tremors and seizures. Intoxication with 1080 causes seizures, random running movements, vomiting, defecation, urination, acidosis and hyperglycemia. Intoxication with rodenticides causing coagulopathy is characterized by hemorrhage into body cavities but not necessarily external hemorrhage. Anticholinesterase insecticides cause salivation, urination and defecation, while chlorinated hydrocarbon insecticides cause CNS disturbances. Ethylene glycol intox...
Palmer AC, Rossdale PD.Brains from eighteen Thoroughbred foals suffering from the convulsive foal syndrome were examined neuropathologically and compared with brains from nine foals dying from different causes. In the brains of nine convulsive foals there was necrosis of the cerebral cortex, accompanied in three by severe necrosis of the diencephalon and brain stem; haemorrhage into the cerebral cortex was also present in most of this group. In the other nine brains from convulsive foals there was haemorrhage, often severe, especially in the white and grey matter of the cerebral cortex and in the cerebellum. Minimal...
Lehner AF, Stewart J, Dafalla A, Ely KJ, Connerly AL, Jones CN, ElkHoly H, Thompson K, Tobin T, Dirikolu L.Gabapentin [1-(aminomethyl)cyclohexaneacetic acid, Neurontin], is a new anticonvulsant used as adjunctive therapy in the treatment of partial seizures in humans not controlled with standard antiseizure drugs, and it has also been used in veterinary medicine. In performance horses, gabapentin is listed as a class 3 performance-enhancing substance by the Association of Racing Commissioners International, and thus is considered to have the potential to influence the outcome of races. Therefore, we developed and validated a sensitive gas chromatographic-mass spectrometric (GC-MS) method for gabape...
Vinardell T, Elestwani S, Jamieson C, Karim E, Robin M, Glynn S, Benini R, Aleman M.A standardized protocol for electroencephalography (EEG) under standing sedation for the investigation of epilepsy in foals is needed. Objective: To evaluate a modified standardized EEG protocol under standing sedation using sublingual detomidine hydrochloride in Egyptian Arabian foals. Methods: Nineteen foals (controls, 9; juvenile idiopathic epilepsy [JIE], 10). Methods: Descriptive clinical study. Foals were classified as controls or epileptic based on history or witnessed seizures and neurological examination. Foals were sedated using sublingual detomidine hydrochloride at a dosage of 0.08...
Nout-Lomas YS.Mechanisms of traumatic nervous system injury to a degree are similar, but differences exist in etiology, pathophysiology, and treatment of brain, spinal cord, and peripheral nerve injury. The most common clinical abnormalities seen in the horse are abnormal level of consciousness, abnormal behavior, seizures, cranial nerve deficits, vestibular disease, tetra- and paraparesis or paraplegia, cauda equina syndrome, specific gait deficits, and muscle atrophy. Treatments are directed toward reducing inflammation and swelling, halting secondary injury, and promoting mechanisms of neuroregeneration ...
Loynachan AT, Williams NM, Freestone JF.A 5-day-old Thoroughbred foal was submitted to the necropsy service at the University of Kentucky Livestock Disease Diagnostic Center. The foal had a clinical history of seizure activity and severe icterus. A complete blood count and serum chemistry analysis indicated that the foal was anemic (hematocrit, 16%), hyperbilirubinemic (45 mg/dl), and hypoglycemic. At necropsy, all tissues were discolored various shades of yellow. Microscopically, there was degeneration and necrosis of cerebral neurons and cerebellar Purkinje cells; severe hepatocellular degeneration and necrosis; and deposition of ...
Ellero N, Lanci A, Avallone G, Mariella J, Castagnetti C, Muscatello LV, Di Maio C, Freccero F.Seizures, coma and death rapidly appeared after admission in a one ‑month‑old foal with a history of lethargy, fever and anorexia. Severe icterus and necrotizing hepatitis were observed at necropsy. Clinical signs, laboratory and postmortem findings were compatible with a suspect of clostridial hepatitis. Tyzzer’s disease was confirmed by the presence of organisms morphologically consistent with Clostridium piliforme in the hepatocytes at the margins of multiple areas of hepatic necrosis. To the authors’ knowledge, this is the first reported case of clostridial hepatitis caused by Clos...
Rissi DR, Avery AC, Burnett RC.T-cell-rich, large B-cell lymphoma (TCRLBCL) is the most commonly diagnosed type of lymphoma in horses. Here we describe the clinical signs, neuropathology, immunohistochemistry (IHC), and PCR for antigen receptor rearrangement (PARR) analysis results of a TCRLBCL in the brain of an 8-y-old male Quarter Horse that was euthanized after acute anorexia, tremors, head pressing, falling, blindness, incoordination, and seizures. Autopsy revealed a firm, smooth, pale-yellow mass that expanded both lateral ventricles and the adjacent subcortical white matter. Histologically, the mass consisted of a de...
Feige K, Eser MW, Geissbühler U, Balestra E, Metzler K.Hirsutism was the most often observed symptom in horses with a pituitary gland tumor and was present in all 13 examined horses. Other symptoms were atrophy of muscles (n = 10), hyperhidrosis (n = 8), polyuria/polydipsia (n = 5), bulging or supraorbital fat (n = 3), polyphagia (n = 2), apathy (n = 2) and seizures (n = 2). Laminitis was the most frequently observed concurrent disease (n = 8). Hyperglycaemia (mean, 9.9 +/- 3.71 mmol/l) in 13 horses and glucosuria (median, 55 [range, 2-55] mmol/l) in 7 horses were the most important laboratory results. The dexamethasone suppression test was positi...
MacDonald KD, Hart KA, Davis JL, Berghaus LJ, Giguère S.Seizures are a common manifestation of neurological disease in the neonatal foal and are an important cause of morbidity and mortality in this population. Current antiepileptic options are effective, but often have undesirable adverse effects, short duration of action and high cost. Levetiracetam has an ideal safety and pharmacokinetic profile in multiple species, including the adult horse, and may be a safe and cost-effective alternative anticonvulsant in neonatal foals. Due to differences in drug disposition and clearance dosages in neonates, dosing recommendations in other species or adult ...
