Analyze Diet

Topic:Comparative Study

Comparative studies in equine research involve the systematic analysis of different horse breeds, management practices, or physiological responses to identify variations and similarities. These studies are instrumental in understanding how different factors influence health, performance, and behavior in horses. Common areas of comparison include genetic traits, nutritional requirements, disease resistance, and response to training. By evaluating these differences, researchers can develop targeted strategies for breeding, healthcare, and training. This page aggregates peer-reviewed research studies and scholarly articles that focus on the methodologies, findings, and implications of comparative studies in the context of equine science.
Non-Coding RNA Sequencing of Equine Endometrium During Maternal Recognition of Pregnancy.
Genes    October 18, 2019   Volume 10, Issue 10 821 doi: 10.3390/genes10100821
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
Effects of Different Freezing Protocols on Motility, Viability, Mitochondrial Membrane Potential, Intracellular Calcium Level, and DNA Integrity of Cryopreserved Equine Epididymal Sperm.
Journal of equine veterinary science    October 17, 2019   Volume 82 102801 doi: 10.1016/j.jevs.2019.102801
Neuhauser S, Bollwein H, Siuda M, Handler J.The aim of the present study was to evaluate the effect of different freezing procedures on sperm motion, viability, the acrosome status, mitochondrial membrane potential (MMP), intracellular calcium content, and DNA integrity on epididymal stallion sperm. Therefore, the sperm of 10 healthy stallions was harvested by retrograde flushing after testectomy, diluted with a semen extender containing defined milk proteins and a freezing extender containing egg yolk and glycerol and frozen according to 4 different protocols, using a programmable freezer and a floating rack performing a slow (processe...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Outcome and complications in horses administered sterile or non-sterile fluids intravenously.
Journal of veterinary internal medicine    October 14, 2019   Volume 33, Issue 6 2739-2745 doi: 10.1111/jvim.15631
Kopper JJ, Bolger ME, Kogan CJ, Schott HC.Obtaining commercial fluids for intravenous administration (IVF) was challenging during a recent shortage. This necessitated use of custom-made non-sterile fluids for intravenous administration (JUGs) in some hospitals. There are no studies comparing outcome of horses treated with JUG versus IVF and limited information is available about adverse effects of JUGs. Objective: To evaluate death, complications, blood pH, and plasma electrolyte concentrations of horses that received JUG versus IVFs. Methods: One hundred eighty-six horses that received IVFs and 37 that received JUGs. Methods: A retro...
Comparative Review of Asthma in Farmers and Horses.
Current allergy and asthma reports    October 10, 2019   Volume 19, Issue 11 50 doi: 10.1007/s11882-019-0882-2
Sheats MK, Davis KU, Poole JA.Farmers are routinely exposed to organic dusts and aeroallergens that can have adverse respiratory health effects including asthma. Horses are farm-reared large animals with similar exposures and can develop equine asthma syndrome (EAS). This review aims to compare the etiology, pathophysiology, and immunology of asthma in horses compared to farmers and highlights the horse as a potential translational animal model for organic dust-induced asthma in humans. Severe EAS shares many clinical and pathological features with various phenotypes of human asthma including allergic, non-allergic, late o...
Culture-independent and dependent evaluation of the equine paranasal sinus microbiota in health and disease.
Equine veterinary journal    October 10, 2019   Volume 52, Issue 3 455-463 doi: 10.1111/evj.13168
Beste KJ, Lawhon SD, Chamoun-Emanuelli AM, Duff AH, Coleman MC, Griffin CE, Hardy J, Whitfield-Cargile CM.Horses with bacterial sinusitis frequently undergo empirical treatment with antimicrobials, however, in some cases bacterial culture of the affected sinus is used to direct therapy. Data regarding which organisms are part of the commensal microbiota of the equine sinus are lacking making it difficult to interpret culture results and guide empiric antimicrobial selection. Objective: Our objectives were to describe the bacterial and fungal microbiota of the paranasal sinuses in clinically normal horses using culture-dependent and independent approaches and to compare the bacterial culture and su...
Co-resistance to Amoxicillin and Tetracycline as an Indicator of Multidrug Resistance in Escherichia coli Isolates From Animals.
Frontiers in microbiology    October 9, 2019   Volume 10 2288 doi: 10.3389/fmicb.2019.02288
Bourély C, Cazeau G, Jarrige N, Jouy E, Haenni M, Lupo A, Madec JY, Leblond A, Gay E.To examine the relevance of co-resistance to amoxicillin and tetracycline as an indicator of multidrug resistance (MDR) in animal health. Methods: isolates collected between 2012 and 2016 by the French surveillance network for antimicrobial resistance in diseased animals (RESAPATH) were analyzed. The proportions of MDR isolates and the proportions of isolates presenting co-resistance to amoxicillin and tetracycline were calculated for seven animal species (cattle, horse, dog, swine, poultry, duck, and turkey). The degree of agreement between these two proportions was estimated by calculating ...
Development of the equine gut microbiota.
Scientific reports    October 8, 2019   Volume 9, Issue 1 14427 doi: 10.1038/s41598-019-50563-9
Lindenberg F, Krych L, Kot W, Fielden J, Frøkiær H, van Galen G, Nielsen DS, Hansen AK.Shortly after birth the mammalian gut is colonized, by a transient microbiota, highly susceptible to environment and diet, that eventually stabilizes and becomes the resident gut microbiota. In a window of opportunity during the colonization, oral tolerance is established towards resident bacteria. In this study, the development of the equine gut microbiota was investigated in ten foals from parturition until post weaning. We found great differences in the core species of the gut microbiota composition between time-matched samples on Day 7 and 20 post-partum. Between day 20 and Day 50 post-par...
In vitro-produced horse embryos exhibit a very narrow window of acceptable recipient mare uterine synchrony compared with in vivo-derived embryos.
Reproduction, fertility, and development    October 8, 2019   Volume 31, Issue 12 1904-1911 doi: 10.1071/RD19294
Cuervo-Arango J, Claes AN, Stout TAE.In recent years, the number of equine invitro-produced embryos (IVP) has increased markedly; as yet, there are few reports on what constitutes an 'ideal' recipient for an IVP embryo. This study retrospectively investigated the effects of recipient mare oestrous cycle characteristics on the likelihood of pregnancy after transfer of IVP (n=264) and invivo-derived embryos (n=262). IVP embryos tolerated only a narrow window of recipient mare 'synchrony', with transfer on Day 4 after ovulation resulting in a higher likelihood of ongoing pregnancy (69%) than transfer on Days 3, 5 or 6 (53.2%, 41.3% ...
An MRI study of solute transport in the intervertebral disc.
Magma (New York, N.Y.)    October 4, 2019   Volume 33, Issue 2 299-307 doi: 10.1007/s10334-019-00781-z
Palfrey RM, Summers IR, Winlove CP.Quantitative magnetic resonance imaging was used to determine partition coefficients and characteristic time constants for diffusion of MRI contrast agents in disc tissue. Methods: Twenty-two excised equine intervertebral discs were exposed to a range of contrast agents: six to manganese chloride, eight to Magnevist (gadopentetate dimeglumine) and eight to Gadovist (gadobutrol), and uptake into the disc was quantified in T-weighted images. Results: Diffusion for all contrast agents was approximately 25% faster in the nucleus than in the outer annulus; disc-average time constants ranged from (2...
Warmblood fragile foal syndrome type 1 mutation (PLOD1 c.2032G>A) is not associated with catastrophic breakdown and has a low allele frequency in the Thoroughbred breed.
Equine veterinary journal    October 4, 2019   Volume 52, Issue 3 411-414 doi: 10.1111/evj.13182
Bellone RR, Ocampo NR, Hughes SS, Le V, Arthur R, Finno CJ, Penedo MCT.Catastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic b...
Metabolic and Endocrine Disorders in Donkeys.
The Veterinary clinics of North America. Equine practice    October 3, 2019   Volume 35, Issue 3 399-417 doi: 10.1016/j.cveq.2019.07.001
Mendoza FJ, Toribio RE, Perez-Ecija A.The donkey evolved under harsh and arid environmental conditions, developing unique energy-efficiency traits, with an efficiency to rapidly mobilize fat in situations of increased energy demands or when food is scarce. This evolution has led to an inherent predisposition of donkeys to obesity, dyslipidemias, insulin dysregulation/metabolic syndrome, pituitary pars intermedia dysfunction, and endocrinopathic laminitis. Marked differences have been described in hormone dynamics and testing protocols for the diagnosis of these endocrine and metabolic diseases in donkeys compared with horses, unde...
Clinical Pharmacology in Donkeys and Mules.
The Veterinary clinics of North America. Equine practice    October 3, 2019   Volume 35, Issue 3 589-606 doi: 10.1016/j.cveq.2019.08.011
Mendoza FJ, Perez-Ecija A, Toribio RE.Donkeys and mules show several pharmacodynamic and pharmacokinetic idiosyncrasies that have to be fully considered by any clinician dealing with these species. Because they possess an increased metabolic rate and cellular water content compared with horses, higher doses (or shorter dosing intervals) are usually recommended for those drugs where pharmacologic studies have been performed. Nonetheless, owing to the lack of species-specific information, this assumption cannot be arbitrarily applied. Thus, when a drug protocol published for horses is extrapolated to a donkey or a mule, a close moni...
A Review of Biomechanical Gait Classification with Reference to Collected Trot, Passage and Piaffe in Dressage Horses.
Animals : an open access journal from MDPI    October 3, 2019   Volume 9, Issue 10 doi: 10.3390/ani9100763
Clayton HM, Hobbs SJ.Gaits are typically classified as walking or running based on kinematics, the shape of the vertical ground reaction force (GRF) curve, and the use of inverted pendulum or spring-mass mechanics during the stance phase. The objectives of this review were to describe the biomechanical characteristics that differentiate walking and running gaits, then apply these criteria to classify and compare the enhanced natural gait of collected trot with the artificial gaits of passage and piaffe as performed by highly trained dressage horses. Limb contact and lift off times were used to determine contact se...
Hoof Disorders and Farriery in the Donkey.
The Veterinary clinics of North America. Equine practice    October 3, 2019   Volume 35, Issue 3 643-658 doi: 10.1016/j.cveq.2019.08.012
Thiemann AK, Poore LA.This article provides a review of hoof anatomy and care in donkeys and mules. Hoof disease is a major cause of poor welfare and mortality globally. Problems associated with hoof disease are discussed in the context of behavior, diet, treatment, and prevention. The most common conditions encountered are discussed, including laminitis, the overgrown unbalanced hoof, white line disease, flexural deformities, and other significant issues. Differences between donkey and horse hoof anatomy are described.
Reference values of hematological and blood biochemical parameters for the Noma horse.
Journal of equine science    October 2, 2019   Volume 30, Issue 3 69-73 doi: 10.1294/jes.30.69
Ono T, Yamada Y, Hata A, Shimokawa Miyama T, Shibano K, Iwata E, Ohzawa E, Kitagawa H.The Noma horse is a Japanese breed from the Noma region of Imabari City, Ehime Prefecture. To obtain reference hematological and biochemical values, we performed examinations in 39 clinically healthy, mature Noma horses managed at the Imabari public ranch. Hematological and biochemical results of Noma horses were close to the normal ranges of horses in the U.S.A. The erythrocyte parameters and hepatobiliary enzyme levels in Noma and Kiso horses were lower than those in Japanese racehorses. Noma horses showed higher erythrocyte parameters and triglyceride concentrations and a lower creatinine c...
Comparison of Serum Amyloid A Measurements in Equine Synovial Fluid With Routine Diagnostic Methods to Detect Synovial Infection in a Clinical Environment.
Frontiers in veterinary science    October 1, 2019   Volume 6 325 doi: 10.3389/fvets.2019.00325
Stack JD, Cousty M, Steele E, Handel I, Lechartier A, Vinardell T, David F.Synovial fluid analysis is utilized to diagnose septic synovitis. However, not all cases are clearly and rapidly discernible with the diagnostic tools available in the laboratory. Serum amyloid A (SAA), an acute phase protein, has been shown to be elevated in synovial fluid from inflamed synovial structures. The goal of this study is to describe the correlation between two diagnostic tests measuring equine SAA levels in septic and non-septic synovial structures and to understand the correlation between an elevated SAA result and synovial sepsis. Prospective estimation of sensitivity (Se) and s...
Ten years of the horse reference genome: insights into equine biology, domestication and population dynamics in the post-genome era.
Animal genetics    September 30, 2019   Volume 50, Issue 6 569-597 doi: 10.1111/age.12857
Raudsepp T, Finno CJ, Bellone RR, Petersen JL.The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromer...
Transition to the ovulatory season in mares: An investigation of antral follicle receptor gene expression in vivo.
Molecular reproduction and development    September 30, 2019   Volume 86, Issue 12 1832-1845 doi: 10.1002/mrd.23277
Ishak GMA, Dutra GA, Gastal GDA, Gastal MO, Feugang JM, Gastal EL.The inability to obtain in vivo samples of antral follicle wall layers without removing the ovaries or sacrificing the animals has limited more in-depth studies on folliculogenesis. In this study, a novel ultrasound-guided follicle wall biopsy (FWB) technique was used to obtain in vivo follicle wall layers and follicular fluid samples of growing antral follicles. The expression of proliferative, hormonal, angiogenic, and pro-/antiapoptotic receptors and proteins in the follicular wall among three follicle classes were compared during the spring transitional anovulatory (SAN) and spring ovulato...
Ex vivo comparison of barbed and unbarbed sutures for the closure of caecal and pelvic flexure enterotomies in horses.
Veterinaria italiana    September 30, 2019   Volume 55, Issue 3 269-274 doi: 10.12834/VetIt.691.3383.2
Giusto G, Caramello V, Comino F, Gandini M.In this study the caecum and large colon were harvested from 24 slaughtered horses. On each sample, an 8‑cm long enterotomy was performed. Enterotomies were closed using either barbed or unbarbed glycomer‑631. We compared the time to close, appearance, length of suture material, bursting pressure, and costs associated with each type of material. Our findings demonstrated that time to close was significantly shorter (caecum, P = 0.034; pelvic flexure, P = 0.039) using barbed sutures (caecum 610.4 seconds; pelvic flexure 699.3 seconds) than unbarbed sutures (caecum 661.0 seconds, pelvic flex...
Prevalence of Clostridium difficile and Clostridium perfringens in Swiss horses with and without gastrointestinal disease and microbiota composition in relation to Clostridium difficile shedding.
Veterinary microbiology    September 29, 2019   Volume 239 108433 doi: 10.1016/j.vetmic.2019.108433
Schoster A, Kunz T, Lauper M, Graubner C, Schmitt S, Weese JS.Overgrowth of enteric clostridia in dysbiosis in horses with colic is presumed but scarcely investigated. The objective was to provide prevalence data of Clostridium difficile and Clostridium perfringens in horses with and without gastrointestinal disease in Switzerland, and investigate microbiota differences between C. difficile shedders and non-shedders. Fecal samples were taken from healthy horses (n = 103), horses with colic (n = 98) and horses with diarrhea (n = 151). Colic horses were sampled on three days. Selective enrichment culture and molecular typing for C. difficile an...
Equine digital tendons show breed-specific differences in their mechanical properties that may relate to athletic ability and predisposition to injury.
Equine veterinary journal    September 23, 2019   Volume 52, Issue 2 320-325 doi: 10.1111/evj.13169
Verkade ME, Back W, Birch HL.Throughout the ages, human subjects have selected horse breeds for their locomotor capacities. Concurrently, tissue properties may have diversified because of specific requirements of different disciplines. Objective: The aim of this study was to compare the biomechanical properties of tendons with different functions between equine breeds traditionally selected for racing or sport. Methods: This study used ex vivo tendons and compared the mechanical properties of the common digital extensor tendon (CDET) and superficial digital flexor tendon (SDFT) between racehorses (Thoroughbred [TB]) and s...
Evaluation of the effect of laboratory methods on semen analysis and breeding soundness examination (BSE) classification in stallions.
Theriogenology    September 23, 2019   Volume 142 67-76 doi: 10.1016/j.theriogenology.2019.09.035
Whitesell K, Stefanovski D, McDonnell S, Turner R.The stallion Breeding Soundness Examination (BSE), as proposed by the Society for Theriogenology, recommends that a stallion produce a minimum of one billion progressively motile, morphologically normal sperm (PMMNS) in the second of two ejaculates collected 1 h apart to be classified as a Satisfactory Prospective Breeder. With this in mind, the first objective of this study was to determine if the classification outcome of the traditional BSE differs depending on the methods used to evaluate sperm motility, morphology and concentration. We hypothesized that application of Computer Assisted ...
Complete Genome Sequence of Escherichia coli Podophage Penshu1.
Microbiology resource announcements    September 19, 2019   Volume 8, Issue 38 e01055-19 doi: 10.1128/MRA.01055-19
Pechacek D, Hwangbo M, Moreland R, Liu M, Ramsey J. 4s is a Gram-negative bacterium found in the equine intestinal ecosystem alongside diverse other coliform bacteria and bacteriophages. This announcement describes the complete genome of the T7-like 4s podophage Penshu1. From its 39,263-bp genome, 54 protein-encoding genes and a 179-bp terminal repeat were predicted.
Signatures of selection in the genome of Swedish warmblood horses selected for sport performance.
BMC genomics    September 18, 2019   Volume 20, Issue 1 717 doi: 10.1186/s12864-019-6079-1
Ablondi M, Viklund Å, Lindgren G, Eriksson S, Mikko S.A growing demand for improved physical skills and mental attitude in modern sport horses has led to strong selection for performance in many warmblood studbooks. The aim of this study was to detect genomic regions with low diversity, and therefore potentially under selection, in Swedish Warmblood horses (SWB) by analysing high-density SNP data. To investigate if such signatures could be the result of selection for equestrian sport performance, we compared our SWB SNP data with those from Exmoor ponies, a horse breed not selected for sport performance traits. Results: The genomic scan for homoz...
Assessment of peripheral markers and ultrasonographic parameters in pregnant mares receiving intramuscular or intrauterine cloprostenol.
Theriogenology    September 17, 2019   Volume 142 77-84 doi: 10.1016/j.theriogenology.2019.09.025
Podico G, Canisso IF, Ellerbrock RE, Dias NW, Mercadante VRG, Lima FS.The present study aimed to compare two methods of prostaglandin-induced abortion in mares by determining blood markers (progesterone, estradiol-17β, alpha-fetoprotein, 13,14-dihydro-15-keto-prostaglandin-F2α (PGFM)), B-mode ultrasonographic parameters, and time until loss of fetal heartbeat. It was hypothesized that intrauterine infusion of cloprostenol results in earlier fetal compromise than intramuscular administration. Ovarian structures (number and sizes of follicles and corpora lutea area), fetal heartbeat, and fetal mobility of thirteen singleton pregnancies were assessed daily by tra...
Collisional mechanics of the diagonal gaits of horses over a range of speeds.
PeerJ    September 17, 2019   Volume 7 e7689 doi: 10.7717/peerj.7689
Hobbs SJ, Clayton HM.One of the goals of the neuromotor control system is to minimize the cost of locomotion by reducing mechanical energy losses. Collisional mechanics, which studies the redirection of the downwards motion of the center of mass (COM) by ground reaction forces (GRF) generated by the limbs, represents an important source of energy loss. The primary objective of this study was to compare collisional mechanics and the associated mechanical energy losses in horses performing diagonally-synchronized gaits over a range of speeds. It is to be expected that collisional energy losses will be high when the ...
Why the long face? Comparative shape analysis of miniature, pony, and other horse skulls reveals changes in ontogenetic growth.
PeerJ    September 16, 2019   Volume 7 e7678 doi: 10.7717/peerj.7678
Heck L, Sanchez-Villagra MR, Stange M.Much of the shape variation found in animals is based on allometry and heterochrony. Horses represent an excellent model to investigate patterns of size-shape variation among breeds that were intentionally bred for extreme small and large sizes. Methods: We tested whether ponies (wither height < 148 cm) have a diverging size-shape relationship in skull shape as compared to regular-sized horse breeds (wither height > 148 cm, here-after called horses) during ontogenetic growth. We used a dataset of 194 specimens from 25 horse and 13 pony breeds, two of which are miniature breeds (wither height <...
Inter-breed diversity and temporal dynamics of the faecal microbiota in healthy horses.
Journal of animal breeding and genetics = Zeitschrift fur Tierzuchtung und Zuchtungsbiologie    September 16, 2019   Volume 137, Issue 1 103-120 doi: 10.1111/jbg.12441
Massacci FR, Clark A, Ruet A, Lansade L, Costa M, Mach N.Understanding gut microbiota similarities and differences across breeds in horses has the potential to advance approaches aimed at personalized microbial modifications, particularly those involved in improving sport athletic performance. Here, we explore whether faecal microbiota composition based on faecal 16S ribosomal RNA gene sequencing varies across six different sport breeds at two time points 8 months apart within a cohort of 189 healthy horses cared for under similar conditions. Lusitano horses presented the smallest and Hanoverians the greatest bacterial diversity. We found subtle bu...
The preliminary studies on protein profile in retained and not retained foetal membranes in heavy draft mares.
Reproduction in domestic animals = Zuchthygiene    September 14, 2019   Volume 54, Issue 12 1543-1551 doi: 10.1111/rda.13561
Wawrzykowski J, Rapacz-Leonard A, Wiącek D, Kankofer M, Janowski T.Protein profile of the placenta expresses its function and maintenance. Any alterations can be reflected in qualitative and quantitative changes in this profile. The aim of the present study was the evaluation of protein profile in the placenta of mares suffering from the retention of foetal membranes (FMR) by two separation methods and the comparison with physiologically released tissues. Placentas from 14 healthy, heavy draft mares were collected immediately after the expulsion of newborn. Tissues after homogenization and staining with fluorescent dyes were subjected to electrophoretic as we...
1 61 62 63 64 65 411