Veterinary medicine for horses encompasses the study and application of medical practices to diagnose, treat, and prevent diseases in equine species. This field involves a comprehensive understanding of equine anatomy, physiology, pathology, and pharmacology. Veterinary practitioners employ a range of diagnostic tools and therapeutic interventions to address health issues in horses, including lameness, gastrointestinal disorders, respiratory conditions, and infectious diseases. Preventative care, such as vaccination and deworming programs, is also a significant aspect of equine veterinary medicine. This page gathers peer-reviewed research studies and scholarly articles that explore various aspects of veterinary medicine as it pertains to horses, including advancements in diagnostic techniques, treatment protocols, and preventive health strategies.
Zubrod CJ, Schneider RK.When medical therapy and surgical treatments of an injured joint fail to return the animal to athletic performance or comfortable use of the limb, arthrodes is is a final option for some joints. Arthrodesis refers to the surgical fusion of a joint, resulting in bony ankylosis. Successful arthrodesis requires debridement of the articular cartilage through the calcified cartilage layer, exposing the subchondral bone; alignment of the joint into a weight-bearing position; and stabilization. The methods by which these steps are accomplished are variable, depending on the individual joint. There ar...
Nollet H, Vanschandevijl K, Van Ham L, Vanderstraeten G, Deprez P.Transcranial magnetic stimulation and measurement of the magnetic motor-evoked potentials (MMEPs) in the thoracic and pelvic limbs of four recumbent horses and one recumbent donkey were used to assess the integrity of the descending motor pathways, in order to confirm or exclude a descending motor tract lesion as the cause of the recumbency. In two of the animals abnormal MMEPs were recorded; in one of the horses a lesion along the cervical spinal cord due to a fracture of the fifth cervical vertebra was diagnosed and confirmed by radiography and postmortem examination; in another horse, damag...
Elia G, Decaro N, Martella V, Campolo M, Desario C, Lorusso E, Cirone F, Buonavoglia C.A real-time PCR assay was developed for detection and quantitation of equid herpesvirus type 1 (EHV-1). The sensitivity of the assay was compared with an established nested-PCR (n-PCR). The real-time PCR detected 1 copy of target DNA, with a sensitivity 1 log higher than gel-based n-PCR. The assay was able to detect specifically EHV-1 DNA in equine tissue samples and there was no cross-amplification of other horse herpesviruses. Real-time PCR was applied to determine EHV-1 load in tissue samples from equine aborted fetuses. The high sensitivity and reproducibility of the EHV-1-specific fluorog...
Walmsley JP.The accuracy of the diagnosis of ligamentous and meniscal injuries in the equine stifle has improved significantly in the last 20 years. There are, however, significant limitations in the diagnosis of stifle injuries because of the size and anatomy of the equine stifle. Treatment of soft tissue injuries to the equine stifle has been empirical,with only a few large case studies for specific conditions of stifle ligaments and menisci and only retrospective case studies of the outcome of treatment. This article describes the diagnosis and treatment of ligamentous and meniscal injuries in the equi...
Valverde A, Gunkelt C, Doherty TJ, Giguère S, Pollak AS.Lidocaine constant rate infusions (CRIs) are common as an intraoperative adjunct to general anaesthesia, but their influence on quality of recovery has not been thoroughly determined. Objective: To determine the effects of an intraoperative i.v. CRI of lidocaine on the quality of recovery from isoflurane or sevoflurane anaesthesia in horses undergoing various surgical procedures, using a modified recovery score system. Objective: The administration of intraoperative lidocaine CRI decreases the quality of recovery in horses. Methods: Lidocaine (2 mg/kg bwt bolus followed by 50 microg/kg bwt/min...
Eliashar E, Dysont SJ, Archer RM, Singer ER, Smith RK.Desmopathy of the accessory ligament of the deep digital flexor tendon (ALDDFT) in the hindlimb is an unusual cause of lameness in horses, and reports of the condition are sparse. Objective: To describe the clinical and ultrasonographic findings, therapy and outcome of 23 horses treated for desmopathy of the ALDDFT in the hindlimb. Methods: Records of 23 horses with ultrasonographic evidence of desmopathy of the ALDDFT in one or both hindlimbs from 3 referral centres were reviewed retrospectively. Age, breed, sex, duration and nature of clinical signs, results of clinical and lameness examinat...
Trumble TN.In horses, lameness is often attributable to some degree of osteoarthritis (OA), a complex disease process that is highlighted by eventual degradation of articular cartilage. Conventional therapies for OA in horses are designed to relieve pain and discomfort and often include pharmacologic intervention with nonsteroidal anti-inflammatory drugs or intra-articular steroids. Oral administration of nutraceutical products to the horse is common and easy and is perceived to be a benign treatment for OA in horses. The main goal for use of nutraceuticals is to use them in OA cases to attempt to lower ...
Frisbie DD.Osteoarthritis is one of the most economically important diseases facing equine practitioners. The loss of use associated with joint disease is a leading problem in the equine industry. Although osteoarthritis in all species is believed to be a multifactorial disease that is not well understood, significant advances are being made. This article presents areas of research that are relatively well developed but have not made it to commercialization or routine clinical practice and looks at new applications being investigated for peo-ple that may have an equine application.
Mazan MR, Vin R, Hoffman AM.Diagnosis of inflammatory airway disease (IAD) currently rests upon the results of bronchoalveolar lavage (BAL) cytology, lung function testing and histamine bronchoprovocation (HBP), none of which provides direct information about structural change in the lung. Objective: That thoracic radiography might better portray structural change in the lungs and therefore offer a good clinical assessment of IAD. Methods: A radiographic scoring system was developed to assess the extent of bronchial and interstitial pattern on thoracic radiographs in the dorsocaudal, dorsocranial and caudoventral regions...
Santos M, López-Sanromán J, García-Iturralde P, Fuente M, Tendillo FJ.To determine the cardiopulmonary effects of desflurane (DES) in horses. Methods: Six healthy adult horses, three males and three females, aged 9 +/- 4 (mean +/- SD) years and weighing 370 +/- 36 kg. Methods: Anaesthesia was induced with an O2 (10 L minute(-1)) and DES mixture (vaporizer setting 18%). After oro-tracheal intubation, horses were positioned in right lateral recumbency. Anaesthesia was maintained with DES in O2 (20 mL kg(-1) minute(-1)) delivered through a large animal circle breathing system. The minimum alveolar concentration of DES (MAC(DES)) that prevented purposeful movement i...
Portus BJ, Reilas T, Katila T.There is conflicting evidence over the role seminal plasma plays in sperm transport and inflammation within the uterus of mares. In in vitro studies, seminal plasma has been shown to reduce polymorphonuclear neutrophil (PMN) function, but the opposite effect on uterine inflammation has been reported in vivo. Objective: To study the effect of seminal plasma on uterine contractility, inflammation and pregnancy rates by inseminating mares with low doses of sperm free from seminal plasma (Group 1) and containing seminal plasma (Group 2). Methods: Synchronised mares were inseminated with 50 x 10(6)...
Maulet BE, Mayhew IG, Jones E, Booth TM.Radiography is a very important aspect of equine stifle imaging. The precise radiographic anatomy of the soft tissue structures of the equine stifle has not been described previously. Objective: To describe the anatomical relationship between sites of attachment of soft tissue structures of the equine stifle and their locations on standard radiographic views. Methods: The sites of bony attachments of the tendons, ligaments and fibrous portion of the joint capsules of equine stifles were determined by gross dissection. These sites of attachment were transposed onto one set of bones deprived of ...
Fortier LA.Systemic therapies for joint disease may be prescribed when a single joint is involved or when multiple sites are affected. The precise therapeutic regimen recommended depends on the duration,cause, and site(s) of injury and is often an adjunct to intra-articular or supportive therapies. If the clinical signs of joint disease are acute and moderate in severity, nonsteroidal anti-inflammatory drugs are often administered to alleviate pain and inflammation. When aiming for more of a generalized maintenance or chondro-protective regimen, an alternative medication, such as hyaluronan,polysulfated ...
Busscher JF, van Duijkeren E, Sloet van Oldruitenborgh-Oosterbaan MM.Two hundred healthy horses housed at 23 different farms and one clinic and 42 persons in close contact with these horses were screened for the presence of methicillin resistant staphylococci. Samples were taken from the nose and the pastern of the horses and from the nose and throat of the humans and incubated in selective media. Isolates were identified by standard techniques and their susceptibilities were tested using an agar diffusion method. Methicillin-resistant strains were tested for the presence of the mecA gene by PCR. In 45 horses (22.5%) and 15 humans (35.7%) mecA positive staphylo...
Musilova P, Kubickova S, Vychodilova-Krenkova L, Kralik P, Matiasovic J, Hubertova D, Rubes J, Horin P.Chromosomal locations of 19 horse immunity-related loci (CASP1, CD14, EIF5A, FCER1A, IFNG, IL12A, IL12B, IL12RB2, IL1A, IL23A, IL4, IL6, MMP7, MS4A2, MYD88, NOS2A, PTGS2, TFRC and TLR2) were determined by fluorescence in situ hybridization. For IFNG and PTGS2, this study is a confirmation of their previously reported position. In addition, microsatellite (HMBr1) was localized in the same region as IFNG. All genes were assigned to regions of conserved synteny and the data obtained in this study enhance the comparative human-horse map. Cytogenetic localization of IL6 to ECA4q14-q21.1 suggested a...
Adami M, Faria MM, Almeida AE, Pinto MG, Prada IL.The present study examined the ultrastructure of the choroid plexus of the lateral ventricle of the horse. The material was fixed in 2.5% glutaraldehyde in 0.1 m sodium phosphate buffer, pH 7.3, processed and analysed by scanning electron microscopy. The choroid plexus was characterized by regions with a predominance of villi, which resembled finger-like projections or bunches of grapes, and others where straight and uniform folds predominated. Epithelial cells projected into the ventricle and large amounts of cilia and microvilli were observed on their surface. The choroid glomus corresponded...
Kamhieh S, Hodgson J, Bode L, Ludwig H, Ward C, Flower RL.Borna disease virus (BDV) is a unique RNA virus that is a cause of neurological disease in horses, sheep and cats. The finding that BDV also infects humans has raised concern related to the impact of infection with this virus. The extent to which BDV may be endemic in geographical regions outside Europe is of interest in management of international movement of animals including horses. Sera from Australian horses (N = 553) sampled in Sydney, New South Wales (NSW), were analysed for BDV antigen, circulating immune complexes (CICs), and antibodies by monoclonal antibody-based ELISAs. One-tenth o...
Milenkovic D, Mata X, Chadi S, Guérin G.Laminins are large heterotrimeric basement membrane glycoproteins composed of alpha, beta and gamma chains. The Laminin 5 isoform has an alpha3beta3gamma2 composition and is essential for the adhesion of basal keratinocytes to the underlying epithelial basement membrane where it is mainly located. Mutations in the genes coding for the 3 chains have been associated with a severe skin blistering disease, Herlitz's junctional epidermolysis bullosa (JEB), observed in different species as man, dog, cat and horse. In this study, we report the sequence of the 5.2 kb horse laminin alpha 3 cDNA (LAMA3)...
Mittelholzer C, Johansson I, Olsson AK, Ronéus M, Klingeborn B, Belák S.Recovery of infectious Equine arteritis virus (EAV) from the semen of persistently infected Swedish stallions was attempted by classical cell culture isolation and by transfection of extracted total RNA. Whereas virus from semen samples stored for several months at -20 degrees C or from extended semen could only be recovered by transfection of extracted RNA, isolation in cell culture was achieved readily with fresh, unextended semen stored at -70 degrees C or directly used after sampling. In parallel, the viruses were examined in the variable region of the large glycoprotein GP5 by nested RT-P...
McGurrin MK, Physick-Sheard PW, Kenney DG.Electrical cardioversion of atrial fibrillation is a well-established technique for restoration of sinus rhythm in humans. While transthoracic cardioversion is more commonly used, transvenous electrical cardioversion (TVEC) has been reported as having higher efficacy at substantially lower energy levels. In horses, treatment of atrial fibrillation has essentially been limited to the administration of quinidine salts either orally or intravenously. TVEC provides an alternative to quinidine salts, especially for those animals in which quinidine is neither effective nor tolerated. The present rep...
Brindley MA, Maury W.Recently, it has become evident that entry of some retroviruses into host cells is dependent upon a vesicle-localized, low-pH step. The entry mechanism of equine infectious anemia virus (EIAV) has yet to be examined. Here, we demonstrate that wild-type strains of EIAV require a low-pH step for productive entry. Lysosomotropic agents that inhibit the acidification of internal vesicles inhibited productive entry of EIAV. The presence of ammonium chloride (30 mM), monensin (30 microM), or bafilomycin A (50 nM) in the medium dramatically decreased the number of EIAV antigen-positive cells. We foun...
Locatelli-Dittrich R, Dittrich JR, Richartz RR, Gasino Joineau ME, Antunes J, Pinckney RD, Deconto I, Hoffmann DC, Thomaz-Soccol V.Antibodies to Neospora sp. and Toxoplasma gondii were measured in mares and precolostral foals from a farm in Parana State, Brazil. An indirect fluorescent antibody test (IFAT) was used to determine specific antibodies. Three sampling points, 2003, 2004 and at parturition were included in the study, but not all horses are represented at a parturition time point. In 2003, antibodies to Neospora were detected in 17 mares (47%) at 1:50 dilution and in 5 mares (13.8%) at 1:100 dilution. In 2004, antibodies to Neospora were found in 11/36 (30%) horses with titers of 1:50 and in 6 mares (16.6%) at 1...
Hurley DJ, Parks RJ, Reber AJ, Donovan DC, Okinaga T, Vandenplas ML, Peroni JF, Moore JN.Administration of black walnut heartwood extract (BWHE) via nasogastric tube induces acute laminitis in horses. However, the processes responsible for the development of laminitis, including laminitis induced with BWHE, remain unclear. The results of recent studies indicate that administration of BWHE initiates an inflammatory response in the laminar tissues and that this response may be due to extravasation of activated leukocytes from the circulation. This study examines the effects of BWHE administration on the dynamics of circulating neutrophils and monocytes, and the capacity of blood leu...
Guan F, Uboh CE, Soma LR, Luo Y, Rudy J, Tobin T.Anabolic androgenic steroids are related to the male sex hormones and are abused in equine sports. In an effort to deter the abuse of anabolic steroids, a sensitive LC-MS/MS method was developed for detection, quantification and confirmation of eight major anabolic steroids (testosterone, normethandrolone, nandrolone, boldenone, methandrostenolone, tetrahydrogestrinone (THG), trenbolone, and stanozolol) in equine plasma. Formation of solvent adduct ions of the analytes was observed under electrospray ionization (ESI) conditions, and desolvation of the solvent adduct ions by source collision-in...
Murray JA, Longland AC, Moore-Colyer MJ, Dunnett C.A series of experiments was conducted to determine the effects of a fibrolytic enzyme preparation (enzyme 1; E1) on the in vitro fermentation of lucerne incubated with equine faecal inocula. In experiment 1, high-temperature-dried (HT) lucerne was treated with five levels of E1 (0 to 2.4 ml/g DM) and incubated at 50 degrees C for 20 h. Samples then received a simulated foregut digestion (SFD) treatment before DM and NSP analysis. In experiment 2, HT lucerne was treated with the same enzyme levels used in experiment 1. Samples were then split into two groups; plus or minus an SFD treatment befo...
Lamas LP, Edmonds J, Hodge W, Zamora-Vera L, Burford J, Coomer R, Munroe G.REASONS FOR PERFORMING THIS STUDY: Intra-articular ethanol has been described to promote distal tarsal joint ankylosis. Its use and results in clinical cases affected by osteoarthritis (OA) have not been reported. Objective: To describe and evaluate the results of treatment of distal tarsal joint OA by facilitated ankylosis stimulated by intra-articular ethanol injection. Methods: Twenty-four horses met the inclusion criteria of tarsometatarsal and centrodistal joint OA diagnosed by a positive response to intra-articular analgesia, radiographic evaluation and recurrence of lameness ≤ 4 month...
de Linde Henriksen M, Andersen PH, Mietelka K, Farina L, Thomsen PD, Plummer CE, Mangan BG, Heegaard S, Coleman JK, Toft N, Brooks DE.To investigate histopathologic and immunohistochemical aspects of equine deep stromal abscesses (DSA) with a focus on the histopathologic diagnosis, presumptive etiology, and the immunohistochemical expression of three angiogenesis-related factors: vascular endothelial growth factor-A (VEGF-A), pigment epithelium-derived factor (PEDF), and interleukin-1 receptor antagonist (IL-1ra). Methods: Paraffin-embedded biopsy samples from 51 DSA. The biopsies were collected from full-thickness penetrating keratoplasty or split-thickness lamellar keratoplasty surgeries at the University of Florida Veteri...
Christensen BW, Roberts JF, Pozor MA, Giguere S, Sells SF, Donahue JM.A 4-year-old Thoroughbred mare was evaluated because of placental abnormalities and a retained placental remnant. Results: Microbial culture of the placenta yielded pure growth of Amycolatopsis spp. Histologic examination of the placenta revealed a focally expanding chorionitis with intralesional gram-positive filamentous bacilli and multifocal allantoic adenomatous hyperplasia on the apposing allantoic surface. Results: Treatment with lavage and oxytocin resulted in expulsion of the placental remnant within hours of parturition. The mare did not become pregnant again despite multiple breeding...
Migdał A, Migdał Ł, Oczkowicz M, Okólski A, Chełmońska-Soyta A.The aim of this study was to investigate the molecular mechanisms leading to the identification of pathogens by congenital immune receptors in foals up to 60 days of age. The study was conducted on 16 foal Polish Pony Horses (Polish Konik) divided into two study groups: control ( = 9) and experimental ( = 7). Foals from the experimental group received an intramuscular duplicate injection of 5 mL of Biotropina (Biowet) at 35 and 40 days of age. The RNA isolated from venous blood was used to evaluate the expression of the, , and genes using RT-PCR. The results of the experiment demonstrated a s...
Fehlberg LK, Lattimer JM, Drouillard JS, Douthit TL.Effects of Co on fiber digestibility in horses are largely unknown. Our objective was to evaluate effects of Co chloride on in vitro gas production, VFA production, and dry matter (DM) disappearance (IVDMD) using cecal fluid from 4 cannulated Quarter Horses. Five grams DM of alfalfa or smooth bromegrass hay were provided as substrate with Co added at 0.0, 0.5, 5.0, 25.0, or 50.0 mg/kg substrate DM. Ten milliliters cecal fluid and 140 mL McDougall's buffer were incubated in duplicate, and pH, VFA concentrations, and IVDMD were measured after 48 hours. Gas production, used as an indicator of...
Leeth C, Adkins J, Hay A, Bogers S, Potter A, Witonsky S, Zhu J.Immunological studies in the horse are frequently hampered by lack of environmental control, complicated study design, and ethical concerns when performing high risk studies. The purpose of the current study was to investigate the utility of a xenograft model for studying acute equine immune responses. Immunocompromised non obese diabetic (NOD). sudden combined immunodeficiency (scid).gamma-/- (NSG) mice were engrafted with either equine peripheral blood lymphocytes (PBLs) or equine bone marrow to determine an optimal protocol for equine lymphocyte engraftment. We found that both PBL and bone ...
Williamson LH, Farrell RL.A case of intracranial schwannoma is described in a young horse. Clinical signs developed slowly and were suggestive of a lesion involving the left cerebrum. The filly exhibited a change in mentation, and circled to the left. Visual impairment and decreased facial sensation were noted on the right side. A solitary schwannoma which compressed the left cerebrum was found at necropsy.
Schumacher J, Schumacher J, Blanchard T.The endometrial response of mares to repair of third-degree rectovestibular lacerations was evaluated. Endometrial biopsy specimens from 8 mares with third-degree rectovestibular laceration were obtained immediately before surgery and from 9 to 15 days after repair. Presurgical endometrial biopsy specimens were classified as category I for 2 mares; category II, attributable to slight endometritis, for 5 mares; and category III, attributable to moderate-to-severe endometritis, for 1 mare. Within 15 days after rectovestibular repair, all endometrial biopsy specimens were classified as category I...
Thakur BP, Sharma SK, Sharma A, Kumar A.Veterinarians working under remote field conditions are routinely presented with variety of surgical interventions in equines like castrations, management of wound, traumatic and congenital hernias and musculoskeletal disorders thus necessitating the use of general anaesthesia for management of these conditions. The present study was carried out to evaluate and recommend the suitable short term anaesthetic technique for Spiti ponies under field conditions. Seven clinically healthy male Spiti ponies presented for castration were evaluated for short term Total Intravenous Anaesthesia (TIVA) usin...
Andrew SE, Brooks DE, Biros DJ, Denis HM, Cutler TJ, Gelatt KN.OBJECTIVE: To describe and evaluate the use of posterior lamellar keratoplasty as a surgical treatment for deep corneal stromal abscesses in horses. Animals studied Nine horses of various breeds and ages that presented with corneal stromal abscesses located in the posterior one-third of the cornea. Procedure Retrospective medical record study. RESULTS: Nine horses had deep corneal stromal abscesses that were treated with posterior lamellar keratoplasty. Median patient age was 3 years. Six patients were females and three were geldings. Medical therapy alone had been attempted prior to surgery i...
Hedenström UO, Olsson U, Holm AW, Wattle OS.It has not yet been shown that ossification of ungular cartilages (OUC) is a pathological condition. Beside heredity, factors such as sex, age, repeated concussion, local trauma, hoof and body size have been suggested as contributing factors for OUC development. By comparing radiographs of front hooves from cold-blooded trotters with different age we wanted to evaluate when development of OUC in cold-blooded trotters occurs and if and when it stabilizes in relation to age and workload. Diagnosis and grading of OUC were based on radiological field examinations of 649 Swedish and Norwegian cold-...
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Bailey RE, Dyson SJ, Parkin TD.The aims of this study were to establish the frequency of occurrence, intensity and symmetry of focal increased radiopharmaceutical uptake in the dorsoproximal aspect of the diaphysis of the proximal phalanx; to determine if this focal increased radiopharmaceutical uptake was related to age, height, gender, breed, bodyweight, or discipline of the horse, and if there was any relationship with lameness. Scintigraphic images from 690 horses were analyzed subjectively and objectively. Age, breed, discipline, height, weight, gender, and lame limb(s) or reasons for presentation were recorded for all...
Turner AS, Yovich JV, White NA, Embertson RE, Santschi EM, Slone DE.A retrospective study was performed to evaluate the healing of ventral midline abdominal incisions, closed with a simple continuous suture pattern using absorbable suture material, in 139 horses and foals. Dehiscence and incisional hernia developed separately in two horses. The low incidence of dehiscence and incisional hernia, compared with their reported incidence following the use of interrupted suture repair, leads the authors to recommend this alternative method of abdominal incision closure in horses. The security of closure is not sacrificed and the advantages of a rapid closure are des...
Muurlink T, Walmsley J, Young D, Whitton C.Current noninvasive techniques for imaging the soft tissue structures of the stifle have limitations. Arthroscopy is commonly used for the investigation and treatment of stifle pain. Cranial and caudal arthroscopic approaches to the femorotibial joints are used. However, complete examination of the axial aspect of the medial femorotibial joint (MFTJ) is not possible currently. Objective: To develop a cranial approach to the caudal pouch of the MFTJ and to assess whether it would allow a more complete examination of the compartment and facilitate the caudomedial approach. Methods: The regional ...
Dean PW.Abnormalities of the nasal cavity, pharynx, larynx, and trachea result in respiratory noise and exercise intolerance. Clinical features of common upper respiratory conditions of performance horses are reviewed with emphasis on diagnosis, treatment, and risk factors that affect the outcome of surgical treatment.
Enders F, Weber A.Fecal samples of 146 horses were culturally investigated for occurrence of Prototheca spp. using a selective medium, developed by PORE (1973). Prototheca zopfii could be isolated in monoculture from 9 fecal samples (6.2%). The results of this pilot study show that horses too can harbour and shed Prototheca spp. in variable frequency.
Loureiro KC, Lima-Verde IB, Johannisson A, Ntallaris T, Jager A, Štěpánek P, da Costa Mendonça M, Severino P, Morrell JM.Cryopreservation of stallion spermatozoa tends to cause plasma membrane damage due to the low ratio of cholesterol to phospholipids. Gums have been suggested as an alternative cryoprotectant to glycerol for stallion spermatozoa. Therefore, the present experiment was designed to verify whether the effect of addition of cashew gum (CG), or nanoparticles (NP) containing CG, to the extender before cooling on sperm quality in stallion semen. Ejaculates from 6 stallions were extended and split between six treatment groups (control, a-tocopherol [TOC], CG1, CG0.5, NP1 and NP0.5), stored in cryotubes ...
Gabriel A, Yousfi S, Detilleux J, Dessy-Doizé C, Bernard C.Navicular bones collected from the four limbs of 95 sound horses were studied. The anatomic bases have been laid down about morphometry of the navicular bones and their variations according to limbs, after corrections have been made for morphologic type, gender, weight, size and age. All the dimensions of the navicular bone (except for the thickness) were larger in the fore limb. This phenomenon probably reflects an attempt to compensate for the greater forces exerted upon the fore limbs during exercise and at rest. Navicular bones collected from the four limbs of 61 sound horses were studied ...
Unt VE, Evans J, Reed SR, Pfau T, Weller R.Conformation in horses is often considered an indicator of athletic ability, performance and resistance to orthopaedic disease. Evaluation is performed in the standing horse and repeatability influenced by stance. Ground reaction forces increase in the moving horse as speed increases. Objective: To determine the effect of locomotion on equine carpus, tarsus, metacarpophalangeal (MCP) and metatarsophalangeal (MTP) joints in the frontal plane. Objective: Valgus/varus angulation will change when moving. Methods: Kinematic data were collected standing, walking and trotting for 2 groups of horses. ...
Beard WL, Robertson JT, Leeth B.Congenital frontal sinus cysts were found bilaterally in the frontal sinuses of a one-year-old miniature horse. Diagnosis was based on radiography of the head and cytologic examination of tissue aspirated from the frontal sinuses. The cysts were surgically removed, using a hinged bone flap technique bilaterally over the frontal sinuses.
van Veggel ECS, Selberg KT, van der Velde-Hoogelander B, Vanderperren K, Cokelaere SM, Bergman HJ. To describe the MRI findings for 13 horses with deep digital flexor tendon (DDFT) injury at the proximal phalanx where the tendon goes from ovoid to bilobed in frontlimbs with tendon sheath distension. In addition, the prognosis of this lesion was assessed. Retrospective case series. Thirteen client-owned horses. Medical records were reviewed, and data were collected regarding signalment, history, MRI findings, and outcomes of horses. Findings of MRI were recorded and whether the case was confirmed with tenoscopy. A diagnosis of DDFT injury at the junction between ovoid and bilobed portio...
Lemes KM, Silva LA, Alonso MA, Celeghini ECC, Pugliesi G, Carvalho HF, Affonso FJ, Silva DF, Leite TG, de Arruda RP.Follicular development and deviation processes during the postpartum period are not completely known in horses. Thus, we aimed to study the characteristics of follicular dynamics and ovarian vascular perfusion during the postpartum period in mares that demonstrated estrous behavior and had early ( 0.1) was detected between the groups when the data were normalized for the days preceding the first postpartum ovulation (from D-7 to D-1). However, when the data were normalized to days postpartum, the dominant follicle was larger (P 25 mm diameter was greater (P 0.1) was detected between grou...
Nichols JL, Robinson JS, Hiney KM, Terry R, Ramsey JW.This study investigated equine nutrition knowledge and educational needs of licensed veterinarians in the United States who were exclusively or predominately equine practitioners. It found veterinarians regard their peers as an important resource of nutritional knowledge, ranking ahead of all other sources except a PhD equine nutritionist. Interestingly, only 21% of veterinarians felt good about their knowledge level in equine nutrition after graduating from veterinary school. Although veterinarians in this study reported equine nutrition to be an area of weakness, 75% had not pursued continui...