Analyze Diet

Genes.

Periodical
Genetics
Genes
Genetic Phenomena
Genomics
Publisher:
MDPI
Frequency: Quarterly
Country: Switzerland
Language: English
Author(s):
Molecular Diversity Preservation International.
Start Year:2009 -
ISSN:
2073-4425 (Electronic)
2073-4425 (Linking)
Impact Factor
3.5
2022
NLM ID:101551097
(OCoLC):641194299
LCCN:2011243179
The Genetic Basis of Obesity and Related Metabolic Diseases in Humans and Companion Animals.
Genes    November 20, 2020   Volume 11, Issue 11 1378 doi: 10.3390/genes11111378
Wallis N, Raffan E.Obesity is one of the most prevalent health conditions in humans and companion animals globally. It is associated with premature mortality, metabolic dysfunction, and multiple health conditions across species. Obesity is, therefore, of importance in the fields of medicine and veterinary medicine. The regulation of adiposity is a homeostatic process vulnerable to disruption by a multitude of genetic and environmental factors. It is well established that the heritability of obesity is high in humans and laboratory animals, with ample evidence that the same is true in companion animals. In this r...
Gene Expression Profile in Similar Tissues Using Transcriptome Sequencing Data of Whole-Body Horse Skeletal Muscle.
Genes    November 17, 2020   Volume 11, Issue 11 1359 doi: 10.3390/genes11111359
Lee HY, Kim JY, Kim KH, Jeong S, Cho Y, Kim N.Horses have been studied for exercise function rather than food production, unlike most livestock. Therefore, the role and characteristics of tissue landscapes are critically understudied, except for certain muscles used in exercise-related studies. In the present study, we compared RNA-Seq data from 18 Jeju horse skeletal muscles to identify differentially expressed genes (DEGs) between tissues that have similar functions and to characterize these differences. We identified DEGs between different muscles using pairwise differential expression (DE) analyses of tissue transcriptome expression d...
An Integrative miRNA-mRNA Expression Analysis Reveals Striking Transcriptomic Similarities between Severe Equine Asthma and Specific Asthma Endotypes in Humans.
Genes    September 28, 2020   Volume 11, Issue 10 1143 doi: 10.3390/genes11101143
Hulliger MF, Pacholewska A, Vargas A, Lavoie JP, Leeb T, Gerber V, Jagannathan V.Severe equine asthma is an incurable obstructive respiratory condition affecting 10-15% of horses in temperate climates. Upon exposure to airborne antigens from hay feeding, affected horses show neutrophilic airway inflammation and bronchoconstriction, leading to increased respiratory effort. The resulting implications range from welfare concerns to economic impacts on equestrian sports and horse breeding. Immunological and pathophysiological characteristics of severe equine asthma show important parallels with allergic and severe neutrophilic human asthma. Our study aimed at investigating reg...
Coat Color Roan Shows Association with KIT Variants and No Evidence of Lethality in Icelandic Horses.
Genes    June 22, 2020   Volume 11, Issue 6 doi: 10.3390/genes11060680
Voß K, Tetens J, Thaller G, Becker D.Roan (Rn) horses show a typical seasonal change of color. Their body is covered with colored and white hair. We performed a descriptive statistical analysis of breeding records of Icelandic horses to challenge the hypothesis of roan being lethal in utero under homozygous condition. The roan to non-roan ratio of foals from roan × roan matings revealed homozygous roan Icelandic horses to be viable. Even though roan is known to be inherited in a dominant mode and epistatic to other coat colors, the causative mutation is still unknown. Nevertheless, an association between roan phenotype and the K...
An Independent Locus Upstream of ASIP Controls Variation in the Shade of the Bay Coat Colour in Horses.
Genes    May 30, 2020   Volume 11, Issue 6 606 doi: 10.3390/genes11060606
Corbin LJ, Pope J, Sanson J, Antczak DF, Miller D, Sadeghi R, Brooks SA.Novel coat colour phenotypes often emerge during domestication, and there is strong evidence of genetic selection for the two main genes that control base coat colour in horses- and . These genes direct the type of pigment produced, red pheomelanin () or black eumelanin (), as well as the relative concentration and the temporal-spatial distribution of melanin pigment deposits in the skin and hair coat. Here, we describe a genome-wide association study (GWAS) to identify novel genic regions involved in the determination of the shade of bay. In total, 126 horses from five different breeds were r...
Absence of Strong Genetic Linkage Disequilibrium between Single Nucleotide Polymorphisms (SNPs) in the Prion Protein Gene (PRNP) and the Prion-Like Protein Gene (PRND) in the Horse, a Prion-Resistant Species.
Genes    May 7, 2020   Volume 11, Issue 5 518 doi: 10.3390/genes11050518
Won SY, Kim YC, Do K, Jeong BH.Prion disease is a fatal neurodegenerative disorder caused by a deleterious prion protein (PrP). However, prion disease has not been reported in horses during outbreaks of transmissible spongiform encephalopathies (TSEs) in various animals in the UK. In previous studies, single nucleotide polymorphisms (SNPs) in the prion protein gene () have been significantly associated with susceptibility to prion disease, and strong linkage disequilibrium (LD) between and prion-like protein gene () SNPs has been identified in prion disease-susceptible species. On the other hand, weak LD values have been r...
Microfluidic Quantitative PCR Detection of 12 Transgenes from Horse Plasma for Gene Doping Control.
Genes    April 23, 2020   Volume 11, Issue 4 457 doi: 10.3390/genes11040457
Tozaki T, Ohnuma A, Kikuchi M, Ishige T, Kakoi H, Hirota KI, Kusano K, Nagata SI.Gene doping, an activity which abuses and misuses gene therapy, is a major concern in sports and horseracing industries. Effective methods capable of detecting and monitoring gene doping are urgently needed. Although several PCR-based methods that detect transgenes have been developed, many of them focus only on a single transgene. However, numerous genes associated with athletic ability may be potential gene-doping material. Here, we developed a detection method that targets multiple transgenes. We targeted 12 genes that may be associated with athletic performance and designed two TaqMan prob...
Gallop Racing Shifts Mature mRNA towards Introns: Does Exercise-Induced Stress Enhance Genome Plasticity?
Genes    April 9, 2020   Volume 11, Issue 4 410 doi: 10.3390/genes11040410
Cappelli K, Mecocci S, Gioiosa S, Giontella A, Silvestrelli M, Cherchi R, Valentini A, Chillemi G, Capomaccio S.Physical exercise is universally recognized as stressful. Among the "sport species", the horse is probably the most appropriate model for investigating the genomic response to stress due to the homogeneity of its genetic background. The aim of this work is to dissect the whole transcription modulation in Peripheral Blood Mononuclear Cells (PBMCs) after exercise with a time course framework focusing on unexplored regions related to introns and intergenic portions. PBMCs NGS from five 3 year old Sardinian Anglo-Arab racehorses collected at rest and after a 2000 m race was performed. Apart from d...
Characterization of A Homozygous Deletion of Steroid Hormone Biosynthesis Genes in Horse Chromosome 29 as A Risk Factor for Disorders of Sex Development and Reproduction.
Genes    February 27, 2020   Volume 11, Issue 3 251 doi: 10.3390/genes11030251
Ghosh S, Davis BW, Rosengren M, Jevit MJ, Castaneda C, Arnold C, Jaxheimer J, Love CC, Varner DD, Lindgren G, Wade CM, Raudsepp T.Disorders of sex development (DSD) and reproduction are not uncommon among horses, though knowledge about their molecular causes is sparse. Here we characterized a ~200 kb homozygous deletion in chromosome 29 at 29.7-29.9 Mb. The region contains genes which function as ketosteroid reductases in steroid hormone biosynthesis, including androgens and estrogens. Mutations in genes are associated with human DSDs. Deletion boundaries, sequence properties and gene content were studied by PCR and whole genome sequencing of select deletion homozygotes and control animals. Deletion analysis by PCR in ...
Androgen Receptor Gene Variants in New Cases of Equine Androgen Insensitivity Syndrome.
Genes    January 10, 2020   Volume 11, Issue 1 78 doi: 10.3390/genes11010078
Villagomez DAF, Welsford EG, King WA, Revay T.In the domestic horse; failure of normal masculinization and virilization due to deficiency of androgenic action leads to a specific disorder of sexual development known as equine androgen insensitivity syndrome (AIS). Affected individuals appear to demonstrate an incoherency between their genetic sex and sexual phenotype; i.e., XY-sex chromosome constitution and female phenotypic appearance. AIS is well documented in humans. Here we report the finding of two novel genetic variants for the AR-gene identified in a Tennessee Walking Horse and a Thoroughbred horse mare; each in individual clinica...
Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.
Genes    January 10, 2020   Volume 11, Issue 1 doi: 10.3390/genes11010082
Hales EN, Esparza C, Peng S, Dahlgren AR, Peterson JM, Miller AD, Finno CJ.Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role ...
The First Report of Genetic and Structural Diversities in the SPRN Gene in the Horse, an Animal Resistant to Prion Disease.
Genes    December 28, 2019   Volume 11, Issue 1 39 doi: 10.3390/genes11010039
Won SY, Kim YC, Kim SK, Jeong BH.Prion diseases are fatal neurodegenerative diseases and are characterized by the accumulation of abnormal prion protein (PrP) in the brain. During the outbreak of the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, prion diseases in several species were reported; however, horse prion disease has not been reported thus far. In previous studies, the shadow of prion protein (Sho) has contributed to an acceleration of conversion from normal prion protein (PrP) to PrP, and the shadow of prion protein gene () polymorphisms have been significantly associated with the susceptibi...
Genomic Divergence in Swedish Warmblood Horses Selected for Equestrian Disciplines.
Genes    November 27, 2019   Volume 10, Issue 12 doi: 10.3390/genes10120976
Ablondi M, Eriksson S, Tetu S, Sabbioni A, Viklund Å, Mikko S.The equestrian sport horse Swedish Warmblood (SWB) originates from versatile cavalry horses. Most modern SWB breeders have specialized their breeding either towards show jumping or dressage disciplines. The aim of this study was to explore the genomic structure of SWB horses to evaluate the presence of genomic subpopulations, and to search for signatures of selection in subgroups of SWB with high or low breeding values (EBVs) for show jumping. We analyzed high density genotype information from 380 SWB horses born in the period 2010-2011, and used Principal Coordinates Analysis and Discriminant...
Genome-Wide Association Analyses of Equine Metabolic Syndrome Phenotypes in Welsh Ponies and Morgan Horses.
Genes    November 6, 2019   Volume 10, Issue 11 893 doi: 10.3390/genes10110893
Norton E, Schultz N, Geor R, McFarlane D, Mickelson J, McCue M.Equine metabolic syndrome (EMS) is a complex trait for which few genetic studies have been published. Our study objectives were to perform within breed genome-wide association analyses (GWA) to identify associated loci in two high-risk breeds, coupled with meta-analysis to identify shared and unique loci between breeds. GWA for 12 EMS traits identified 303 and 142 associated genomic regions in 264 Welsh ponies and 286 Morgan horses, respectively. Meta-analysis demonstrated that 65 GWA regions were shared across breeds. Region boundaries were defined based on a fixed-size or the breakdown of li...
A Mechanogenetic Model of Exercise-Induced Pulmonary Haemorrhage in the Thoroughbred Horse.
Genes    November 1, 2019   Volume 10, Issue 11 880 doi: 10.3390/genes10110880
Blott S, Cunningham H, Malkowski L, Brown A, Rauch C.Exercise-induced pulmonary haemorrhage (EIPH) occurs in horses performing high-intensity athletic activity. The application of physics principles to derive a 'physical model', which is coherent with existing physiology and cell biology data, shows that critical parameters for capillary rupture are cell-cell adhesion and cell stiffness (cytoskeleton organisation). Specifically, length of fracture in the capillary is a ratio between the energy involved in cell-cell adhesion and the stiffness of cells suggesting that if the adhesion diminishes and/or that the stiffness of cells increases EIPH is ...
Frameshift Variant in MFSD12 Explains the Mushroom Coat Color Dilution in Shetland Ponies.
Genes    October 19, 2019   Volume 10, Issue 10 826 doi: 10.3390/genes10100826
Tanaka J, Leeb T, Rushton J, Famula TR, Mack M, Jagannathan V, Flury C, Bachmann I, Eberth J, McDonnell SM, Penedo MCT, Bellone RR.Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation ( = 2.08 × 10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of var...
Non-Coding RNA Sequencing of Equine Endometrium During Maternal Recognition of Pregnancy.
Genes    October 18, 2019   Volume 10, Issue 10 821 doi: 10.3390/genes10100821
Klohonatz KM, Coleman SJ, Cameron AD, Hess AM, Reed KJ, Canovas A, Medrano JF, Islas-Trejo AD, Kalbfleisch T, Bouma GJ, Bruemmer JE.Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Ea...
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Genes    October 16, 2019   Volume 10, Issue 10 816 doi: 10.3390/genes10100816
Rivas VN, Aleman M, Peterson JA, Dahlgren AR, Hales EN, Finno CJ.Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the () gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffec...
Coding RNA Sequencing of Equine Endometrium during Maternal Recognition of Pregnancy.
Genes    September 25, 2019   Volume 10, Issue 10 749 doi: 10.3390/genes10100749
Klohonatz KM, Coleman SJ, Islas-Trejo AD, Medrano JF, Hess AM, Kalbfleisch T, Thomas MG, Bouma GJ, Bruemmer JE.Equine maternal recognition of pregnancy (MRP) is a process whose signal remains unknown. During MRP the conceptus and endometrium communicate to attenuate prostaglandin F (PGF) secretion, sparing the corpus luteum and maintaining progesterone production. Recognition of a mobile conceptus by the endometrium is critical by days 14-16 post-ovulation (PO), when endometrium produces PGF, initiating luteolysis. The objective of this study was to evaluate endometrial gene expression changes based upon pregnancy status via RNA sequencing. This experiment utilized a cross-over design with each mare se...
Differential Gene Expression in Articular Cartilage and Subchondral Bone of Neonatal and Adult Horses.
Genes    September 25, 2019   Volume 10, Issue 10 745 doi: 10.3390/genes10100745
Kemper AM, Drnevich J, McCue ME, McCoy AM.Skeletogenesis is complex and incompletely understood. Derangement of this process likely underlies developmental skeletal pathologies. Examination of tissue-specific gene expression may help elucidate novel skeletal developmental pathways that could contribute to disease risk. Our aim was to identify and functionally annotate differentially expressed genes in equine neonatal and adult articular cartilage (AC) and subchondral bone (SCB). RNA was sequenced from healthy AC and SCB from the fetlock, hock, and stifle joints of 6 foals (≤4 weeks of age) and six adults (8-12 years of age). There w...
Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.
Genes    September 5, 2019   Volume 10, Issue 9 doi: 10.3390/genes10090681
Marquardt SA, Wilcox CV, Burns EN, Peterson JA, Finno CJ.Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nuc...
Origin and Evolution of Deleterious Mutations in Horses.
Genes    August 28, 2019   Volume 10, Issue 9 649 doi: 10.3390/genes10090649
Orlando L, Librado P.Domestication has changed the natural evolutionary trajectory of horses by favoring the reproduction of a limited number of animals showing traits of interest. Reduced breeding stocks hampered the elimination of deleterious variants by means of negative selection, ultimately inflating mutational loads. However, ancient genomics revealed that mutational loads remained steady during most of the domestication history until a sudden burst took place some 250 years ago. To identify the factors underlying this trajectory, we gather an extensive dataset consisting of 175 modern and 153 ancient genome...
Genomic Regions Associated with IgE Levels against Culicoides spp. Antigens in Three Horse Breeds.
Genes    August 8, 2019   Volume 10, Issue 8 doi: 10.3390/genes10080597
François L, Hoskens H, Velie BD, Stinckens A, Tinel S, Lamberigts C, Peeters L, Savelkoul HFJ, Tijhaar E, Lindgren G, Janssens S, Ducro BJ, Buys N....Insect bite hypersensitivity (IBH), which is a cutaneous allergic reaction to antigens from Culicoides spp., is the most prevalent skin disorder in horses. Misdiagnosis is possible, as IBH is usually diagnosed based on clinical signs. Our study is the first to employ IgE levels against several recombinant Culicoides spp. allergens as an objective, independent, and quantitative phenotype to improve the power to detect genetic variants that underlie IBH. Genotypes of 200 Shetland ponies, 127 Icelandic horses, and 223 Belgian Warmblood horses were analyzed while using a mixed model approach. No s...
A High Protein Model Alters the Endometrial Transcriptome of Mares.
Genes    July 30, 2019   Volume 10, Issue 8 doi: 10.3390/genes10080576
Boakari YL, Ali HE, Dini P, Loux S, Fernandes CB, Scoggin K, Esteller-Vico A, Lawrence L, Ball B.High blood urea nitrogen (BUN) decreases fertility of several mammals; however, the mechanisms have not been investigated in mares. We developed an experimental model to elevate BUN, with urea and control treatments (7 mares/treatment), in a crossover design. Urea-treatment consisted of a loading dose of urea (0.03 g/kg of body weight (BW)) and urea injections over 6 hours (0.03 g/kg of BW/h). Control mares received the same volume of saline solution. Blood samples were collected to measure BUN. Uterine and vaginal pH were evaluated after the last intravenous infusion, then endometrial biopsie...
Landscape of Overlapping Gene Expression in the Equine Placenta.
Genes    July 2, 2019   Volume 10, Issue 7 503 doi: 10.3390/genes10070503
Dini P, Norris J, Ali HE, Loux SC, Carossino M, Esteller-Vico A, Bailey E, Kalbfleisch T, Daels P, Ball BA.Increasing evidence suggests that overlapping genes are much more common in eukaryotic genomes than previously thought. These different-strand overlapping genes are potential sense-antisense (SAS) pairs, which might have regulatory effects on each other. In the present study, we identified the SAS loci in the equine genome using previously generated stranded, paired-end RNA sequencing data from the equine chorioallantois. We identified a total of 1261 overlapping loci. The ratio of the number of overlapping regions to chromosomal length was numerically higher on chromosome 11 followed by chrom...
Genome-Wide Homozygosity Patterns and Evidence for Selection in a Set of European and Near Eastern Horse Breeds.
Genes    June 28, 2019   Volume 10, Issue 7 491 doi: 10.3390/genes10070491
Grilz-Seger G, Neuditschko M, Ricard A, Velie B, Lindgren G, Mesarič M, Cotman M, Horna M, Dobretsberger M, Brem G, Druml T.Intensive artificial and natural selection have shaped substantial variation among European horse breeds. Whereas most equine selection signature studies employ divergent genetic population structures in order to derive specific inter-breed targets of selection, we screened a total of 1476 horses originating from 12 breeds for the loss of genetic diversity by runs of homozygosity (ROH) utilizing a 670,000 single nucleotide polymorphism (SNP) genotyping array. Overlapping homozygous regions (ROH islands) indicating signatures of selection were identified by breed and similarities/dissimilaritie...
The Genomic Makeup of Nine Horse Populations Sampled in the Netherlands.
Genes    June 25, 2019   Volume 10, Issue 6 doi: 10.3390/genes10060480
Schurink A, Shrestha M, Eriksson S, Bosse M, Bovenhuis H, Back W, Johansson AM, Ducro BJ.The spectrum of modern horse populations encompasses populations with a long history of development in isolation and relatively recently formed types. To increase our understanding of the evolutionary history and provide information on how to optimally conserve or improve these populations with varying development and background for the future, we analyzed genotype data of 184 horses from 9 Dutch or common horse populations in the Netherlands: The Belgian draft horse, Friesian horse, Shetland pony, Icelandic horse, Gelder horse, Groninger horse, harness horse, KWPN sport horse and the Lipizzan...
Satellite DNA at the Centromere is Dispensable for Segregation Fidelity.
Genes    June 20, 2019   Volume 10, Issue 6 469 doi: 10.3390/genes10060469
The typical vertebrate centromeres contain long stretches of highly repeated DNA sequences (satellite DNA). We previously demonstrated that the karyotypes of the species belonging to the genus are characterized by the presence of satellite-free and satellite-based centromeres and represent a unique biological model for the study of centromere organization and behavior. Using horse primary fibroblasts cultured in vitro, we compared the segregation fidelity of chromosome 11, whose centromere is satellite-free, with that of chromosome 13, which has similar size and a centromere containing long s...
Genome-Wide Association Studies Based on Equine Joint Angle Measurements Reveal New QTL Affecting the Conformation of Horses.
Genes    May 14, 2019   Volume 10, Issue 5 doi: 10.3390/genes10050370
Gmel AI, Druml T, von Niederhäusern R, Leeb T, Neuditschko M.The evaluation of conformation traits is an important part of selection for breeding stallions and mares. Some of these judged conformation traits involve joint angles that are associated with performance, health, and longevity. To improve our understanding of the genetic background of joint angles in horses, we have objectively measured the angles of the poll, elbow, carpal, fetlock (front and hind), hip, stifle, and hock joints based on one photograph of each of the 300 Franches-Montagnes (FM) and 224 Lipizzan (LIP) horses. After quality control, genome-wide association studies (GWASs) for t...
Droplet Digital PCR Detection of the Erythropoietin Transgene from Horse Plasma and Urine for Gene-Doping Control.
Genes    March 21, 2019   Volume 10, Issue 3 243 doi: 10.3390/genes10030243
Tozaki T, Ohnuma A, Takasu M, Kikuchi M, Kakoi H, Hirota KI, Kusano K, Nagata SI.Indiscriminate genetic manipulation to improve athletic ability is a major threat to human sports and the horseracing industry, in which methods involving gene-doping, such as transgenesis, should be prohibited to ensure fairness. Therefore, development of methods to detect indiscriminate genetic manipulation are urgently needed. Here, we developed a highly sensitive method to detect horse erythropoietin () transgenes using droplet digital PCR (ddPCR). We designed two TaqMan probe/primer sets, and the transgene was cloned into a plasmid for use as a model. We extracted the spiked transgene f...